GenePrediction:GLEAN_1218 Details

Name: GLEAN_1218
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1430934..1433061 (+ strand)
Length: 2128
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1430934..1431066 (+ strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_173:1431136..1431251 (+ strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_173:1431304..1432399 (+ strand)
Length: 1096
Type: CDS
Source: GLEAN
Position: GCSC_173:1432661..1433061 (+ strand)
Length: 401
>GLEAN_1218 class=GenePrediction position=GCSC_173:1430934..1433061 (+ strand)
ATGGCGTACGAACCGCGAGGGGACTATGGAGGAGGAGGCGGAGGTGGAGGTGGTGGAGGGGGTGGTGGTGGTGGAGGAGG
CCACTACGGACAGGACGGCGGTGCTGCAGGATTTGTGCGGGCACGGGGACGACGTGAGTGCTAGGCGACCTCGACATCTT
TGCCGCTACTTTCAGCCACTGATAAAAGTCGACATTGAACAGGTCCTGTGACGGATTATGGGGCGACCTTGGTGCACTGG
ATGCGGCACCGGCAGCCCAAGTACCGAGACGCCTACACGGGCGAGGTGGAGCGGCCGAGTGCGAGCTACATTGTCGATGT
GAGCGTCCTGTGTGTCGATCTGGCGTCCCTTCTCGCGGCTGATGTGTTAGATGCTCCCACCGGCGGCGCGGGTGACCAAC
GCGGCCGACAGCGTGCCGACACGGTACCTGCACTCGTCGCAGAACAAGATCAAGCACCCGGTCAACGTGGTGCGGTGGAC
GCCCGAGGGCCGGCGGCTGCTGACGGCGTCGAGCAGCGGCGAGTTCACGCTCTGGAACGGGACGGGCTTCAACTTTGAGA
CGATCATGCAGGCACACGACTCGGCGATCCGGGCGTTGGCCTACTCGTACAGCGACGACTGGCTCATCTCGGCCGACCAC
GACGGCATGATCAAGTACTGGCAGCCCAACTTCAACAACGTCAAGAGCCTGGCAGCCCACAACGAGCCGATCCGCGACCT
GGCCTTTGCCCCGACAGACGCCAAGTTTGTCACGGCCTCGGACGACTCGACCCTCAAGATCTTTGACTTTGCAGCCGCCC
GACCGGAGGCCACGCTGGCCGGCCACGGCTGGGACGCCAAGACGTGCGACTGGCATCCGACCAAAGGCCTGGTCGTGTCG
GGCTCCAAGGACCACCTGGTCAAGCTCTGGGACCCGCGCTCCGGCCGCTGTCTGACCACGCTGCACGGCCACAAGAACAC
GATCACAAAGACGGCCTTTGAGCGTGTGCGCGGCATGTGTCTGGCCACGGCTGCCCGCGACCAGACAGCCCGCGTGCTAG
ACCTGCGCACGATGCGCGACATCTGCCTCTTGCGCGGACACGACAAGGACATCTCCACGCTGGCCTGGCATCCCGTGCAT
GCCAATCTGCTGAGCACCGGTGGCAGCGATGGTGCCCTGTTTCATTACCTGCTGGACGAGCCGAACACGCCGGCAGGTCA
GCCGACGACGCAGGCCCCTTTTGACAGTCCCGATCCCTCCACAGCACCGGCCCAGAGCATCTTCCCGGCCCATCGCCTGC
CCTACGCCCACGACTTTGCCATCTGGTCGCTCGACTGGCACCCGCTCGGCCACATCCTCGTGTCCGGCTCCAACGACCGG
CTGACCCGCTTCTGGACTCGAGCCCGGCCGGGCGAGGACATCTCGCGCGACCGCTATCACATCGGCGAGGCCGCAGCCGA
GGCCCAGGGCACCTGGGACCGACGTGGTAACCGGCGCCAGCGCCAGGAGGACGAGGAACAGGAGATGGAGGACGAGATGG
AGGGCCTGGTCGACCAGAAGATGCCGCTTCGCCAGCATCAACACCAGCAGCACGCGCCAGCCACATCGGCCGCTGCTGCT
GCTGCCTTTGCCGCTGCTACCGCGGCCAACGGCGGCGTTCCTCCTCCCCTGTTGCCTGGCCTGTCGCTTCCTGGCATTGG
CCTCAACGCCAGCGGTCATGGTCATGGTCACATTCCGCCACCGCCAGCTGCTTTGGCCGCCGGTGGCGCCTTTCCCCCGC
CACCGTTTGCGCTGCCTGGCGTCGACCCGAGGAACCCGCCTGACCCGGCCAGGATGCTCGAGATCATGCAGAAGGCCGGC
ATCAAGCTGCCGCCACCACCACTGCCCGGCGGCTCGCGCATGCTTCCAGGCCTGATCCCACCACCACCGCCACCTGGGTC
TCAGGCTGCTCCATCCGGTGGCAGTGGGACGGCCGCTCCGTTTGGGCTGCCGCCGGGCTTCCCTGCGTCGATACCCGGGA
TGGGAGCTCTGCCGGGCCTCAGCCTGGACCACCAGCAGTCGCTGGACAAGCGGAGAGCGCCGCTGCCAAGCCAGGAGGAG
AGCCTGCGCGAAGAGCAGAAGAGGGGCCACTACACACAACGGCGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62