GenePrediction:GLEAN_1219 Details

Name: GLEAN_1219
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1440175..1441865 (+ strand)
Length: 1691
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1440175..1440244 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_173:1440298..1440428 (+ strand)
Length: 131
Type: CDS
Source: GLEAN
Position: GCSC_173:1440492..1441865 (+ strand)
Length: 1374
>GLEAN_1219 class=GenePrediction position=GCSC_173:1440175..1441865 (+ strand)
ATGGTTTTTGTTGTCCGTGCCGTGCCGGACGATCGGCGCGGCTGGATCCTGTGTGTTGTCAGCGCGATAGGTATGTGGTG
ACGGTCGACAGTATCCCCACTGATCGTTGACTGACTCTTGCAGCATGTATCTTCGGTGCCTGCTTCATCTGCGTTGACGT
CTTTGTGCGTCTCCTTCCTGGCCAGAAGGACTTTCGCATCGAGGACAGCAATGCGTTTCTGGCCAGCTCTCTGAGCCTCA
GTTTTGGCGTCATGGTATGCATCTCATCATTTTCTCTTCATCCTCGGCCAGACCAGCTGTTGCTCACACCACCGCAGATA
TTTTCGGCCCTCTTCAGCATGCTGCCATCCTCCAAGCGCTACCTCATCGCCGACGGCGTCCCCAAGCAGCGGGCCGGCCT
CTTGATGATGGCTGCCTTTGTCGTCGGCTTTGTGGGCATCCAGGTGGTGTCCCGGATCATCCACCGGTTCATGCCTTCGC
ACGTGGTTGACTGCGACCACTCGCACGAGGACGACGGCGCAGACGAGAACGGGCACGATCACAGCCACAAGAAAGGCCAC
AAGAACGGCCACCCGTCGTCCCTTCGGCGATCCTCTGGCCACACCGGGGCCGACGGTGGCTCTGACATGACCGAGTCCAC
ACCGCTGCTGTTGGCGGCCAGCAACGGTCACGTGACATCTTCCTCAGACGAGTTTCCCGCGACGCTCAGTCTGTCACGAC
AGCACAGCCAGCCGCTGCCGCGGCCGGCGGCGATCCGACGGCAATCGATGAAGGAGGTGGTGCGCGATCGACTGGTGTCG
TTTGTCAAGGACACGAAGACCAACTGCGACGAGTTTGGGCCGTGCTACGGCTATTCGGATCCGTGCGGCCAGGAGTGCAA
GACACATCTAGCGACGCGCGTGCCTGCGCCGCTGCGTGAGGTGACGTCGTCTCTGCATCGGACGCCATGGAGCCTCTCTT
CGGAGAACGTGACGGTGCTGCCAGTGTCGATCGAGGAGCGAAGCAGCATCGAGGACGCCGGCAGCTCATCCGGGATGGCT
GGGCCGGCAGAGCTGTCGACCGGCACAGACACGGCGTCCATTGCGGGCTCCAAAGACGGAGCCGACGAGAGCAGACAGGA
TGCGAGCAGCCAGCAGGCGCCACCCGATGCGGACACCGATCTCGAGGCTGCAGCTGCACCGCCGCATCACCACCACGTGC
CGACCAACGCGTTCCTGTCGATCGGCGTGCAGACAGTGCTCGCGATCGGGCTGCATAAGTTTCCCGAAGGCTTCATCATG
TTTGCGACGAACCACGCGAACCCGGCGCTGGGGCTGAACGTGTTCCTGGCGCTGCTGGTGCACAACGTGGCCGAGGGCTT
TGCCATGGCCCTGCCGCTGTACATGGCTCTGGGCAGCCGTCTGCGGGCGATCGCGTGGGCGTCGGCACTGGGCGGCTTGA
GCCAGCCGCTGGGTGCCGGCGTGGCCGCCATCTGGCTGTGGTATCTCGGTCGGGGCGACAGCGACAATGACAAAAACAGC
CAGGGCACCGCCTACGGACTGCTCTTTGGCGTGACAGCCGGCATCATGGTGGCCGTGGCGCTGCAGCTCTTTGTCGAGGG
CCTGATGCTGCACCACAACCGGCAGCTCTGCATCGGCTTCGGCTTCGTCGGGATGCTGCTGCTGGGGCTCAGCAACGCGC
TGGTGAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62