GenePrediction:GLEAN_121 Details

Name: GLEAN_121
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:825207..827048 (+ strand)
Length: 1842
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:825207..825463 (+ strand)
Length: 257
Type: CDS
Source: GLEAN
Position: GCSC_179:825527..825911 (+ strand)
Length: 385
Type: CDS
Source: GLEAN
Position: GCSC_179:825992..826544 (+ strand)
Length: 553
Type: CDS
Source: GLEAN
Position: GCSC_179:826615..827048 (+ strand)
Length: 434
>GLEAN_121 class=GenePrediction position=GCSC_179:825207..827048 (+ strand)
ATGGCTTCCCCGTACACAATCCAGTCTGAATCTAGACAGCTTCTCGAACGCCTGCTGAACGATCCAAAGTTATCTGTCCC
CAATGAGGTAAAGGAGGCAGCGGAGAGAGTTGAGTTCAGTGGATACGCCAACCCGTGGCTGCCAGTTCCTGTCAAGTTCA
GCGAGTCCATCTCGGCCATCTCGGCGTTTGTTGGCGCAAGCGCAGCTGCTGTGGCTAAAGACCGCTACGGGATTGAACAG
GACATTAGAGTGAATACGTAAGAAGCGTCTGCAAGAACCCATAATACGCAGCACGGGCTAATCGCTTCTTGGCGGCACAG
TGATCATGCCTCCGTCCTCCTGTTCGGGTTCTTCCTGCCTCACATCGCCGGAGAGTCGATTATGACAGCATCAAAGGCCA
TCCTCGAGAACTTGGCCGAGGTGGACAAGAACAATCTGTTCAAGCCGATCCACAGAGCCAGTACAAACCAATACAAGACG
AAGGACGGGCGATACTACCACGTTCACGGTTCAATGAACGCGACCGTCATCATGGACATGTTCAAAATTGCCGAACAAGA
TGTCACACTCGAAGAGGCCAAACAAATATACGCAGACAAGGTGGCTCAGTATGATGCCGAAGAGCTTGATCAACTAGAGA
ATGAAGTGTACCGCCAAGCAGGAACAATTTGCTATACGCCGGAGGAGTTCTTTGCCACAGAGCACGTACGTTAACGCAGC
TGGCCAGGCAGGAATCGGCGCTTCTTTCCCCTCTTTAGATACCAGGCCTGACCAATCTCTTACAGGGAAAAATCGCGGCT
CAAGAGCCCATCGCTTCCATCAAAGAGCTACCAGCGCCTCAGAAAGCCTGGCCAAGCCCGGCCGCTGGGTCCGAGTTTCG
GCCGCTTCACGGTATCCGGGTCGTCGACATGTCTCGTGCTGTAGCAGCCCCCATGGTTTCCAAGATCTTAGCTGCCCTCG
GTGCCGACGTGATCAAGGTTTCCTGCCCTTCGCTTCCCGATACCGGCATTGCGATGGTAGACGTTAATGCTGGAAAGCGG
GACGTCAATATCGATTTGAAGACGGAAGAGGGCAAGACGCTGTTCCGCAAGATTATTAAGGATGCCGACGTTCTTGTCGA
TGGGTACCGGCCTCATGCCATTGAGAAGCTCGGCTTCCACTCCAAAACGCTGCGCGAGCTGAATCCTTCTCTGATCTATG
TCCGGGAAGACTGCTACGGCTACAATGGTCCATGGGCTCACCGCTCTGGCTGGCAGCAGATTGCCGATTGTACTGTCGGG
CTTGCCCTGATGACCGGTGAATTTCTGGGTCTCAAGGAGCCCATTCAGCCTCTGCTACGTAAGCAAAGAATTCTCGCCCT
GCCTATTTAGGAGACGCGAAGTGTCCGCTAACTTATTTCAAACAACAGCCAACGCAGACTACCAGACAGGTGTTTTGGGT
TCCGGTCTGGTCATCCAAGCGTTGATGAAACGCACCAAAGCTCCTGTCACCTTTGATATCGATCTTTCCTTGTGCCATTA
CAACATCTGGCTGTACCGTGTCGGGGTCTACACTCCTGAGCAGCAGGCTTCTATTCGGGCACTTCACCCCGAGTTCAAGC
CTCGCCACACGACCGACCTGCCGGAAATTGCGGGGATGTTGATGGAATCGCTAAAGACAGCTCGGCCAGGCATATTCAAG
ACTCCGGGTTTCTACGAGGAGATCTCTGGAAAAGAGTGGGGTGAAGAGCGCCTCATCAATGTCATTGGCGCCCCTTTCTC
GCTCACAGAGTCCACTCTCGGGTTCCTGGTGCCATCTGGAAGACGTGGCTGGTCTAACGCAAACCCCACATGGGTCGTAT
AA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62