GenePrediction:GLEAN_1220 Details

Name: GLEAN_1220
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1444233..1444859 (+ strand)
Length: 627
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1444233..1444270 (+ strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_173:1444335..1444634 (+ strand)
Length: 300
Type: CDS
Source: GLEAN
Position: GCSC_173:1444703..1444859 (+ strand)
Length: 157
>GLEAN_1220 class=GenePrediction position=GCSC_173:1444233..1444859 (+ strand)
ATGTCCGAGTACGGCGACGACGATGGGGGCAACGGACAGTACGTGTATTTTACTCTGGACGTGACCTTGCGTAACAGCGC
TTCCCGGCTAACCGTGCTCCAGCGACGAGCCCCTGTACGACGAGGACGAGGGCCAGGACTACTTTGAGCCTGAGGTGCCG
GCCGAGGACGAGGAAGGCGGTTTCAACGGGACCAACGGCCGCAGCGGCGACGACGATGTGGACATCCTGCCAGCAAACGA
CCCTTCGGCCATGGCGAGTCAGAAGAACGCGGCCAGCGGCCCACGGAACAACGTCAAGTCGCACAAGGACAAGAAGATTC
CGAACGACCAGCGGTCGACCACGCCGTTTCTGACAAAGTACGAGAAGGCGCGCATCCTCGGGACGCGTGCTCTTCAGATC
AGGTGCGTAATTGACTCCCATTTTTCATCTGTCCTCCCGTTTCGTATTGGCTGTCCTAACGTCCCCCCAGCATGAACGCT
CCCGTGCTGGTCGACCTCGAGGGCGAGACCGACCCGCTGCAGATCGCCATCAAAGAGCTGCGCGAGAAGAAGGTGCCCCT
GATCGTGCGGCGCTACCTGCCCGACGGCTTCTACGAGGACTGGACGTGCGAGGAGCTGCTGCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62