GenePrediction:GLEAN_1222 Details

Name: GLEAN_1222
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1451404..1452607 (+ strand)
Length: 1204
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1451404..1451569 (+ strand)
Length: 166
Type: CDS
Source: GLEAN
Position: GCSC_173:1451747..1452119 (+ strand)
Length: 373
Type: CDS
Source: GLEAN
Position: GCSC_173:1452439..1452607 (+ strand)
Length: 169
>GLEAN_1222 class=GenePrediction position=GCSC_173:1451404..1452607 (+ strand)
ATGCAGCCGGGAGGGGGGGAGGAGAGAGAGGGGGCGTTCTGTCCTTCCGACGGCTGGCAGACCGGAACGGGGACGGGGAT
GCTGGATGGCAGAGGTGGCAGGCGAGCAGAGGACGAGCGTGCAGAGAGCTCGACGGACGGCGAGGGCGAGAGAGGTGTTT
CGAACGGTAAGATGTCTGCCTGGACGACGGTCGGATCAGAAGCAGATCGGCTCGGAGCAGGGTTCTGATTCGTGGGGGGA
GGGAAAGGGCATCGCTCTCCTTTTTCTGGCTTTCCTTCTTCCTGCCGTGTTTTGCTCTTGCGCTCTGCTCCAGTTTACCG
GATGGGATACTATCGAATAATAGGAGAGACCGAGCAGACAAGAGAGCAGCCTGTGGAAATTTTCGCTACGTGTATCCCCA
CTGTCGAGGCCGGTAGCGACTACCTGTGGGACAGCGGGCGCTCACACTGCCGCCAAGGTCACCAGTACACGTGTCCTGCG
ATTGGCCCTGCAGGGGTGAAAGCGTATAGGCGCTGCGAGATGCCTTCATATTCACGACATCGCGTACGGGTGCGAGCGCG
ATACGAGCACGGCCCTGAAGCTTGCCCTACGAGCGCACACGCGCACGCACACGAGCCAGCCGCTCATTGCAGGACCGCCC
AGGACTCCCTGGCCGAGGTCCTGCCAGCGGCTTTGCCGGCTTTGCATACGACGTACCCCGTACGAACCCAGGCATCGTAA
GCCCTGTAATACGGAGTGCGGGCAACTGTGCCAACGCTACCCCTACAGCCTACAGCGCCCGCTAGACGCCGGCAGCGGGT
CGGCTGCCCCTAAGGGGCTTCCCGCCCAGTGCTCCCGCTCTGTAAAAACAGCGCATCCGCATGTTGTCCAGATCAGCGCA
GGCCTTGCAGGCTGCTTGCAGGGGCCTGGCACGCCCTCCCACGGCAGAACGTGAGGGGCGCTCCTGCACTGTCCGATTCT
CGAAGCTTCGGTGGGGCAGAGACAGACATGGAAAGGCTCGTGGGTCAGGCAGAAATTGCGTTGCCCGCGGAACAGGCATT
CCTATGCGGCTGACAAGGCTGCACCGCCGCCGTGTTGCAGCAGAGCCCGTCACATCACCTTTTTCCCTGGCCGTGTGACT
GGTCAGTCTGGTGCCATCACGGCTCGATACGACTGTGCTCAAATCGCGTCCAAGCAGAAAGAACGGGCTCTTGCGAGCCA
CTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62