GenePrediction:GLEAN_1223 Details

Name: GLEAN_1223
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1454826..1457789 (+ strand)
Length: 2964
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1454826..1455836 (+ strand)
Length: 1011
Type: CDS
Source: GLEAN
Position: GCSC_173:1455890..1457233 (+ strand)
Length: 1344
Type: CDS
Source: GLEAN
Position: GCSC_173:1457286..1457789 (+ strand)
Length: 504
>GLEAN_1223 class=GenePrediction position=GCSC_173:1454826..1457789 (+ strand)
ATGGCATCCATCCAGGTCGCCCAGCCGACCAAGTCGCGCCAGCACAGTATCAGCGGCAGTTCCGTGTCGACGCAGGGCAG
TCCTCCGCACTCTCTCTCGAGGAAGCCAGGCCGGGCCTCTCTCGCGGTGCAGGCTGCCCAGCCCAACATGTCGAGCAGCA
CGCCACTGCTTCGGCCACCATCCCAGCAGCCGCCGCCCATCCCGGAACAGTTGTCAGCGTTGGCATCGGCGCCGGTCTCG
TCCGACGTCGACCGCACGTCCAACCAGAGCGCCAAGTCCATGCACGCACCCTCGACCGACACGGCCGTCTCGTCGCAGCA
CTCGTCACTATCCGGCTCCGGCGCTGCTGCCATCGCCGTGGCCGCCCGCCACTCCAACCCGGATGCACACCCGCCGCGCA
AGCTGCGGTCACAGTACCCCAGAGGCGCAACCGAAAACCATGTGGAGTACATCCTGGTGGCCTCGTTTGACATCGACAAG
GGCCCCATCATGGAGCATCAGTATCCCGTGGCCATCACGGGTGACGAGCACATGCTGGCCGAGCTTATGCTGCCCGACCA
GACCCATCTGCGCAACCAGGACTGGACCATGTTCTTCCTGCACAAGGACACCACGCCCGAGGAGGAAGATCAGGAGCGGC
TCGAGAAGGCGCGGCGTCGGGAGAAGCGCAGGCGCAAGCATGGCCACGTTGCCACCACCGACAACATCAAAACAACCGAC
GGGACTGAGACGAACGGGCTGTCCGAGTCGGATGCCGACAACGAAGAAGCGCCCGAGAAAGACAAGGACGCAGACGACAA
CGACAACGACGATTACGACGACGACGATGACGATGACGATGAAGACGAGGACAGCATGTCGACGGACAGCGAGCCGGAGG
GCGGCGAGGGCGCCCCGCTGATCTATGTCCTGAACCTTGTCAACACGAAGCAGGACAAGACGCAGAAGCGTGGCGCTGTG
GTCAAGTCCATGGCCATCTGCACGCGCCATCCCTTCCTGCACATATACAAGGTGAGCCTCCCATCAAATCACGTGACTGT
CACACAACTAACAGTACGAACCAGCCGCTGCTCCTGCTCGCACTCGAGGAGTACTTCAAGTCGCCGGTGCCAGAGACGCT
GTCGATGCTGTACGAGGCGGTCAATGCGATGGACCTGTCGCTGCTGCCGCGGCTCAGCCGGCTGGAGCGCCACCTGCTGC
AGGCGAGCGAGAACAAGGACCTGTTTGTGGACAAGTTTGAGCAGATGATCCAGATGCGGATCGCGGCCGAACGCGGCGAC
GGCATGGCCGGCCAACCGCTAGACGCAAGCCGCAGCCCGCCCAAGCCGGCTGGCGCGATTCTGCGGTCCGGCACCAAGGC
ACACTTTGAGGGCCACGCAACAGCCTATGCGGTGCCGCGCGACACGCACGAGTTTGAGAGCAAGGTGCTCTACAAGGGCA
TCCCGATCCCGATCAAGGTGCCGGTGGCCGTGATGCCCGAAAACGTCGGCGACTTCTCGCTCGTGAAGCTGATCCAGAAC
TTTGCCGACCCGCACGCGAAACAGCCACAGCCGTTTGCAGCACACGCCCATCTCACAACTAGCGGCCCGCTGACTCATCC
AATCATCGTCCTCGTCAACGCCCTGCTGACCCAGAAGCGCATCATCTTCCTCGGCCACAACATGCCGTCGGGCGAGGTGG
CCGAGGCCGTGCTGGCAGCCTGTGCCCTCGCCTCTGGCGGCGTTCTCCGCGGCTTCACTCGCCACGCCTTTCCCTACACG
GACCTGACCAAGATTGAGGATCTGTTGCTGGTCCCCGGCTTCATCGCCGGCGTCACCAACCCGACCTTTGAGCTGCACCC
CGAATGGTGGGACCTGCTGTGCGACCTGCCGTCGGGCCGCATCAAGATCAGCTCCCGCATCGAAGACGCCCCCATCACCC
AAGGCCTGCTCTCCTTCAAGCAGCAGCATCCGGCCTATGCTGCCCTCGTCAATACTTCTCTGACTCCGGCCTCGTCCTCG
GCCTCAGCTGTGGCTGCCACTGCCAGCGCCGACCTCACTGGTGACAACGCCTTCATGGCCGACATTCTCAAGAGCATCCA
CGCCCGTCTCGGCGAGCGCGCCATCCGGGCCAAGTGGCGCGATTGGGTCGTCAAGTTTACCCGCATCGCCGCCGCCTTTG
AGGAGTCCGTCTATGGTGCCAGCGTCCTCAACTCCGACAGCGCTGACTATGCCGCCGACCTGACTGCCAACTCGCCCGTT
GCCACCACGCCCACCGCCGCCATTCCCACCAACAACAGCTTCACCGCCACCTCCACCGGTCACGGCTACGTCTGGGCCGA
CGACAACGCCAAGCAGCGTGAGCTGGCCGGCAACGTCACCCGCGTCGAGGGCTGGCGCAACACCAGGAGCTACCTGAGCT
TCATCAAGGTGGGTTTCTCCTCTTCTTTTTTCCTCCCCCCGCTCCTACTAACACCCCCAGGACGTCGCTCAGCAAATCAC
CGTTCGCCCCCTCAAAGGCCTCGACCTACACCACATGCACGACCGCCTGCGCACCCAGCGCCTGACGCCGGCACAGAGCC
GCGAAATCTACCTGACCCTGTCCCGCCATGTGTACTCGTACGACGAGATCTGCCTGCTGCTCTCCGTCGCCCCCGAGTCG
CACGGCGGCCTCTTCTACGTTGCCCTCGGCCTCTTCCACCGGGACAAGGACGTCCGCACCAAGACGACCGAGCTGCTCGA
GCGCATCAGCGAGCACGAGGCCGGCCGCCATTGGTGGCAGGGCCTGAGCCGCTTCGAGAAGATGGCCTACATGCGCATCC
GCCGCGACGACGACGCCGAGATGCGCGGCAAGCTCGAGAAGGAAGGCCTCGTCAACCAGGCTGCCGCCGCCGCAGCAGCA
CTTGCCGCCGCTGGCAATGGCAGCGGCAATGGTGGCAGTTCTGCTGCTGCCAACACCGTCCTCGTCGATCCGCGCTCCAG
CTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62