GenePrediction:GLEAN_1224 Details

Name: GLEAN_1224
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1466642..1471467 (+ strand)
Length: 4826
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1466642..1466780 (+ strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_173:1467054..1470457 (+ strand)
Length: 3404
Type: CDS
Source: GLEAN
Position: GCSC_173:1470541..1471029 (+ strand)
Length: 489
Type: CDS
Source: GLEAN
Position: GCSC_173:1471087..1471467 (+ strand)
Length: 381
>GLEAN_1224 class=GenePrediction position=GCSC_173:1466642..1471467 (+ strand)
ATGTCGGACGAGGTGTCCAACTTCCTGCGCTCGGTCGAGCAGCTCAAGGATCGGCGGCTGGAGGAAGATGAGGCTCGCTC
GCGCGAGCTCGAGGAGAAGATCCTGCAAGAGAAGCGGGAGCGCCAGGCGCGCCGAGAAGGTACGATAAGTCCAGTACTGT
GATCGTGGGATGGCCCGTTCAGTCGGCCTGGCTGTTCCTTGTGTCTTTCGGTCGTAGAGGCTGGCTTTCCAGGCTGTCAT
TGGGCGGTCTTGACTGCGTTGCGTCGATGATGCCTTACATCCCTTTCGGGCAGGAGCTGGCCTCCTCACCGGCCGGCAGC
TCCTTCCCTTCTTGCTTCTGAACTTGGGCCGCGTCAGGTTTCTGGAAGGCCTTCCACCTCTTTTCCCTGTTTTCTCTGCT
AATGCCTTCCAGAACGTGCCAGATCAATTTCCCCTCAGAAATCGTCTCCCGCCAACACGCCACCACCGTCCTCGTCTCAT
CACCGCTACAACAGCTCGCAGTCGGATGTGCTGAAACCGGCGTCTCCCTACAACAGTCCCTCATCTCGTTCCAACAACCG
TCCCGGTGGTTCTGCCCTGGAATCGAGCTCTGATGCTATGGGCACTCCTTCGTCTTCGTCGACAAAAGAAAACGAGTCCC
CCTTTGATGCCGACGGAAAAGCATCCGCCACTTTTGGTGCGGGACGGACCCCGACGCTCTCGTGGCAGAGACGGCCGACG
TCGCTCAGCGTGTCGGCCTCTGACCGGCCCAAGATACGCCCTCTCTCCATGGTTGCTGCCGAGAATGCTGCTGCTCGTTC
GTCGGTCGTCTCTGTTGGCTCCCCTGGAATCACAAGTGTTGGCGGCGAATCGGCCGAGCCTGATGCTGAGCCTGACGTCT
CGCGTGACCAGATTGCGCATGCACTGTCTTCCAAAGATCCGTCCTGGTTCCGCCAAACAGCCGATCGTGGCCTCAACTCT
GCTGCGTATCGCCGCACCCAGGTTGAGGACAACGACCGCCAGGACATGACTGCCGCCCCTACTCAGCTGCCCGGGATGGT
TCGTGCCCCTTCAACGGAGCCCGAGCCTGCCCCACAATCTCCCTCCACTTCGTCTTTCTCCGCCCTACAAGCCGGCACCA
TCCCGACCGGTACTGTCTCTCCCATGACACCCACCCAAAAGCTGGACCCTCCAGTGGATTCGCTCTCGTCGCCGCCTGCC
TCCGGCTGGTCAACGCCCACGCGGCCACGGTCACCTACAAAGGGTGCTGGCGGCTTTGTCCAGAGCGCCATGATGAAGAG
GAGCGACAGCGTGAAGCGATGGAGCGTCACATCGCCCCCTAGCCTTCAGCGAGTCGACAACGTTGCATCTGTTCGGCCTG
AGGGCGGGCGTCGAACAGGCCCCCAGCCGGCCACCACGTCCCGGCCAACATCCAGGGACGGTCGGGCTTCTCCAACCAAG
GCTCAGGCTAGCAATAACACAGCAAGCGCATCAGCCCCGGCGCCAGCTGAAGAAGAGCATGTTGACGCGGGCCACGAAGA
TGAAGAAAAGACGTCATCCCTACCCGTAAGCCCATCCAAGACAATGGATCCGCGGAGATGGAGCCCGAACAAAACATCGA
GCTGGCTCGAAGCCGCGCTCAACAAGCCCGACTTACCGAAACCTAAGATGGCAGCCTCGCTGAACAACCAGCCCGCATGG
ATGGTTGAGTTGAGCAAGCAAAAGGCGCAGAAGGCCGGGAGCACTACCGGCTCCGAAATTGCGACACCCCCAACGCCTGT
AACGCACAAGCATGAAGTAAAGACTGGTGGGCTGATGAGGTCGTCGCCAATGGGTGCGACTGCAGCAGCCGCCGCATTGA
AGCCTTCTGTGCCTCTCCCTATCTCCGTACCTGTGCCTGGCCGAAGCGGACGAGGTGGCTTTCATACGCACTCGGCGTCT
GTTAGCAGTATAACCGGCAAGAGTGGGATCGAGCTGCCATTGGCGCCAACTACACCAACGAGCCTGGATTTCCGGACCAA
CTTGAAGCCTCGCCAGCCACTGCCGACGGACACGAAGAAAGACGATGGTAATGAGAACGAGCTTCAGAGTGTTTTTGGCT
CATTACGGCGTGCAAAGACACAAAACTTTAAGGCACCAGATATATTGAAGGACAACATTCTTCGTGGTAAGAAGTCGCTC
AACTTCACAGGCGGGCCAAAACCGCGGGAGAAGAAGGATGAATTCAAGGATGCCATACTTCAGAAAAAGGCCGAGTTCCA
GCAGGCAAAGTCAGAGGGTCGTGGCATAATGGCCAATGCTCTTGACCATGATGACGAGCCTGTTCTCCCTGAGGGTCTGG
CGAAGAGGCTGGAGATGAGCCGTACGGGCTCCAAATCAATCTCACCGACCCGACGAAATCGAGCGACTTCGGAAGTAAAC
CCAGGAGCAGACGCTCGTCGGGCAGAGGCTGGCGTCTTCGGCCGCACAAGTCGAGCCTTGACTGTCTCGAAGAGAGAGAC
TGGCAATACCGCCTCAGTTTCTGCAGAGCAAGAATCGACTACGCCTTCCACCAGGGACAGCGGGATTCTCCGCGGTGGCC
CTCAGCTGGGAGGTGGGAGCGCTCTTGCAAATCGGTTCAACTCGTCCTTGGCAGGAATGTTGGCGCGTGGCCCTCCTGGA
GCGGCACCTGGAGCATCCACGGCGTCTTCCGGGCCGTCGTCTTCCGCTGCTGAAGCACCACAGGGGCCAGGACCTCAACT
GACACACATGACTAAGGGTCGTGCCCGTGGTCCGAAGAGAAAGGCCCCGTCAAGCTTACAGCAGAGCAAATCAGCCGAAG
AACCGGCCAAGACGGAAGATAACCCCCAAAGGTTGTCTCCACCACCCATTATGCCCAAGAAGATTGAAACGGGCACGAAG
CCTTCTCCCCTGGTCGATTTGACGAAGAAAATGGGTCCCGAACCGACTGTCGCTGGCCGAAGCAGCGTGTTGCCGCTCGT
CGACTCGTTCAGGAAACGAGCAGAGTCGACAACGCCCTTGCCAATGGGGGCTGCGATTCCGCCGCTGGAGTCACCGAGAG
TTGGCGGGCGGCCGCGGTCTCCGACGAAAATCCACGAGCAAATTGCTGCCATTGCCGCCAGAGGTGCGCAGGCCATTCCG
GCAGAAGAGACGGTGACCTCGCCGGTTTCTTCTCCGCGGAAGCTGGACGTGAAGAGGATGTCCAAGTTCTTGCAAGAAGT
GCCAAGCCCGAACGCGGCGCCAGCAGTTGAAGTTCCAAGGCCGCTGTCGCCATCGAAGACAGGAGGTCCAAGGCCTCTGC
CTCAACCGCGGGCACTCTCCCCTCAAAAGACGGGAGGCTATGTTCGGCCGTTGCCCCCAGCACCAGTGTCTCCTGAGGTT
GCGGCACCACAGCACTCGATTGCTCCAGCGAGCATCCCTGCCTTCTCACCTCGACAGCAGAACAAGCTCGAGAGTCCGGG
GCCGGAAAAACGGGCGGAGTCGCCGATACCTGCACCACTGTCGATGCGGCCTTTGTCCGTGTCGCCGCGACCTTCGACGA
CGCCGCCACCTCTGCTATCGCCTTACAGATCGGCAGCGAAGCAGGCCCAAGAAGTGTCGGGGATGCTGAAAGATTTTTTT
GGACCGGATCGATCCCGGCGCACATACCGTGCAGACGTGGGAGGGCTACTGTCAAGGCGGCCAGCAGGGGAAGCGAAGGT
CAACAGCATTTCGTCACAGCTCTTCCGGGTATCTAGCGATGGCAGGAAACAGCCGGTGCCTGCGCTGTATGAGCGGGTGC
TCTTCGAGGGCGAGATGTATCTCTGCCCACACACGTTTGTCGACGAGCGGGGCGTTGTAAAGTGAGCGAGGTGTACTTCT
GGGCAGGCGACGAGGTGCCACAGTCGATGGTGGAGGATACACAATTGTTTCTGGGCCAGGAGGCACGGGCGCTCGGCGGA
AAGCTGGTGGAGCTGCGGCAAGGCAAGGAGACGGCGGAGTTTCTGCAAGCACTGGGCGGTGTGGTGACATTCCGGCGTGA
AACGAGCAGCAAGTATGACCAGTTGGCACCAAGCATGCTCTGCGGACGGCGATTCCTCGGGCAGATCGTGTTCGACGAGG
TGGATTTCGCGACGACCAGCCTGTGCTCGGGTTTCCCGTTCCTGATTACGCAACAGGGCGACTGTTACCTGTGGAAGGGC
AAGGGCAGCCACGTGGATGAGTTGAGCTGTGCACGGCTGATTGGTATGGACCTGGCGCTGAAGGGCGAGCTCATCGAGGT
GGAGGACGGACAAGAGGCGGAAGAGTTCTGGACGCTGTTTGGCGGATCGGGCAGCAAGGTCGGCTCTGCAGACCACTGGC
GCCTGAAGCCCAAGTACGACGGCTACTGCGGACGGCTGTTCCGGTCCGATGCTGGCAGCCGCGATCAGGTGAGTGTACCC
GGCCAGCTGTCTGAACATTGCGGGGATTCTGACCAAGGCTCGCAGGTTGTGGAAGTCCACTCGTTTGACCAGCGCGACCT
ATCGGCAGGCGGGATCTACGTGCTGGATGCGTTCTTCGAGATGTACATCATTGTGGGGTACCAGTCACAGGGGCAGTATG
CGAGCTTCCGGAATGCACTGGACTTTGCGCAGGAGTACGCCATTCTGGCTGCGGGCGTAGAGGACCGGCCGTTTGTGCCG
ATTTCGACGGTGGTGCTGGAGGGCATTCCGCGGGATCTCAAGAGCGTGTTCCGGAAATGGCGCGACGATGCCAGCCCGAC
GCGCACGACCGAGACTGTCGGAGCGGTGCAACAAGTGGCGATCAAGCGCAGCCGCAGTTTGCGCGTGGTGCCGCTGACGG
TAGCTCTGCAGGCCTTGGCGGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62