GenePrediction:GLEAN_1225 Details

Name: GLEAN_1225
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1479695..1481326 (+ strand)
Length: 1632
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1479695..1479859 (+ strand)
Length: 165
Type: CDS
Source: GLEAN
Position: GCSC_173:1479932..1480148 (+ strand)
Length: 217
Type: CDS
Source: GLEAN
Position: GCSC_173:1480211..1480608 (+ strand)
Length: 398
Type: CDS
Source: GLEAN
Position: GCSC_173:1481039..1481326 (+ strand)
Length: 288
>GLEAN_1225 class=GenePrediction position=GCSC_173:1479695..1481326 (+ strand)
ATGGCAGACATAATGTCCATGGATAAGAACGACAACATCAAGCATGACTCTGATGACTCGCTCGACTCGGGCGACGAGGG
CATGCAAGCTCCCAACGGTAGCAACCACGCTGCATCCAACTCGCAGGATGGCCAGCCGGTAAAGCGCAAGGGCGGCCGCA
AGCCGGTAAGTCGAAAGAAACGCGCACTACTGCGCCGCCTGGCAGACGGTCTGGGAATGGAGCTGACGACTCTCTAGATA
TACGCCACGTCAGAGGAGCGCAAGCAGCGGAACCGCCAGGCGCAGGCCGCCTTCCGCGAAAGACGAACTGAGTACATCAA
GCAGCTCGAGGAAACTATCCGGGTGCACGAGCAGAATTTGCACAACTTGCAGACGGCCCACCGGCATGCTGCCGACGAGT
GTCTTATGCTGCGGTACAAGAACTCTCTATTGGAGCGCATCCTGCTCGAGAAGGGTCAGTCGTCCCCTGGGCATTTGTGT
ACCCTCGATCATCTCTGACATCCCGTTCTGCTGTAGGCATCGATGTGCAAGCAGAGCTTCGCGCCAAGACAGGAAGTCCC
AGTCTAGGTCCCACGCATATGCCACAGAACATGGTGCAACCACCACCAATTCCCCGGTCCATCTTGAACCGTCACCATGC
GCGCAGATCCAACTCTAGCATCGCACCGAAGCTCGAACCTGGCGTAGCTTCCCTGCCCGGCCATCCCACTCCTACGTCTG
TGGTTGCATCACCAAAGAGCCGGCCCACACCATCGTCTCACTCGGCCTCACCTACCGCCTCGACTTCGGCTTACGGTGCA
TCGCCTGCTGCTTCTATCAACGACCCTTCGTCTTCCATCCGACCTGTTCTCCCTGTGCCTCCGCCACCTCCACAGATGAT
GCAAGCGCACCAGGCGCATCAGGCTCACCAAGCTGTGGCAGCTATGAAGGCAAGCCAGCTGGCCGGCATGGCGGGAATGG
TAGGAGCTTCGCGCACGCTTCAGCAGCAACGGCAGCAGCAACAACGACAGCAGCAACAGCAGCAGCAGCAGCACCAGTAC
CAGCAGCACCAGCAGCATCAGCAGCATCAACAGCACCCGCACCACCACACTGCTCAGCACCATGTGCCGCAGCACATACA
GCACCAGCAGCAGCCCTCGTCGCATCCGCAGCAACAACATGCACCGCTGCCTTCGCCGCAGCCGGTGACACCACGGTCTG
GGGGCGTTGGCTCGACGTCGTTCTATCCAGCTCCATCTTTCCAGAACCATATTGAGCAGTTGGGCAAGTTGACCTCTCCC
CCTTTCAGCCCCATCCCCAATCAGAGCTTTGTCGTCCTAGATTCATTCTGTATTTTTAGAACAGGAATACGACGCCGCCG
ACGATATGATCGAAGACCCGAACGAGAACCCCGATACCCCCGCCGGTCCGTACGCCAACCACGCCTATTCGACTGGTCCC
CCGCCGTTGAGTCTCGCGAGTCCGGCCGCGAGCGCCCCACCTTCGACAGCATCTTCCGTTATCGGCGGCCAAAACGGATA
TCCATCTATGACGCAGCTTCTCGACCCTGCTCTGGATTGGGACCCTTTCGGTCTCAGCGCGAGCATGCAGTTCCCCACTC
AGTTCTCATTCGATACGAGTAACACGAGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62