GenePrediction:GLEAN_1226 Details

Name: GLEAN_1226
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1484018..1484932 (+ strand)
Length: 915
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1484018..1484577 (+ strand)
Length: 560
Type: CDS
Source: GLEAN
Position: GCSC_173:1484773..1484932 (+ strand)
Length: 160
>GLEAN_1226 class=GenePrediction position=GCSC_173:1484018..1484932 (+ strand)
ATGGTCCTCGTCAGATTGACTGCCCCATCCTTACCTGACCGTTCGGCCTGGGACCCTTTCCATTACCATCCTTCTCAGAG
AAAGCTAGACGAAGACAGCTTCGCTGAGATACCATCAAACCTTGGAGGGAACGCCGCTGATATCGAAGTGCGAATTGCTG
GCAATCTCGAACGCTTCGATAAAAACTTTGGATCGGCAGACCTCGATTTTGAAGAAGCTGTAGTCGAAGTCGAGGTGGAA
GACGAAGACGATGACGACGATGAAGACTCCTTCTCCGTCCTTTCTGATGACGGCCTGACCAAAAACATCGAAACGGGCAG
GCTCCTCTACTCTCGCAAACAGCTTTGGGCCTATGAAGAGGGCCTTCGGGACCGAGAAACGGTGACCCTTGCCGTGGGAG
GCTCTGCAAAGGCGGTAAAGATTAAAGAGAAGACATGGAAGCACCGATATCCACCCACAAAGCTTTCACCTGATATCTTC
AACCCTTCATTTGACGACATTCTTGTGAATATTGAAAACTTTATCGACTGCTACAAGTCCGGCTCTGTGCCAGTGACAAA
GTGCATCAAACGCCAGTGCCCAGCCCCTGAAAAAAAAAAAAGCTAGAATGCCAAGAATCGTCCTAGCTGACAAGGCCGAC
AACGGTGTGTGCCTTTTGCTACACTTCCTTGTTTTTTGTACTTTCTCGCAATTGCTTCTCACATGTCTTCATAATATACT
AAATGCTAATTTATAGAATACCACTGGGTTTCTAGACTTGGCGGATTTTCTGAAAAATCAGTCACGGCCAAACACGAAAG
CGAAATCCGGGGTGAAGAGTGGAATGTTTTGGGCTATTATGATGGCATGGAGCCCCATAAGGCAAGTGACGAGCCACTCC
AACCTGAATGGGAAGATCTTGCTCAGATGCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62