GenePrediction:GLEAN_1227 Details

Name: GLEAN_1227
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1486174..1487751 (+ strand)
Length: 1578
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1486174..1486377 (+ strand)
Length: 204
Type: CDS
Source: GLEAN
Position: GCSC_173:1486423..1486441 (+ strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_173:1486678..1486785 (+ strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_173:1486839..1487007 (+ strand)
Length: 169
Type: CDS
Source: GLEAN
Position: GCSC_173:1487058..1487751 (+ strand)
Length: 694
>GLEAN_1227 class=GenePrediction position=GCSC_173:1486174..1487751 (+ strand)
ATGCACGTCCATCGCAAGATCGCCCTCGTCGACCAATCTGCTTCGTCTTGCTTGTATGCGCAGCCGGCCGACAACATTGT
GCCCTTGGCCACGGGCTGCCGGTCGGCATGCGTATACATCTCGCCGGCTTCTCCTGCTGCTCTCCAAGTGGTGGGCGATG
GGGTGTGCCTGCGGATGGAGCAGCAGTCAATGCCTGTCTGGATGGTATAATTGCAGACGCTTATGCTGACTGTCGACTCG
TCCCTGCAGAACCCGTATGACCTCCTCGGTAAGCAAGGCCAAGCCCCACCTCGCCTCTCCACCTCACCCCGCGATGCCTC
CGCTCTCCGATCGCAAGCCCCAGTCGGCCATCTGCGCGCTGTGTGGCGTTTGGTCGGGGCAGCACAGGACCGGGAGGACG
AAGCGCATATCAAAGGGAAAAGCGAACAGATGCAGCTAGATGCAGCGCATCGCGATGTTCGCTGTTGCAAACAGACAACT
AACATGGCATTTTGTCTTCCTTAGGCAACGAGGATGGTGACGTGGACGCAGCTCCCACACAGGCCGCTGGTCGGATCACC
AAGGATGCCAAGCCCCAGGCTGCTCCTCGGCGCACGGCTGGCAACGATGCCGGTAGGTTCCCCCCGGACAGCTGCTGTCA
ATTTGGCTGGACGACCGCTAAGTAGTGCCAGCCTTCCGTGACCGCAACGCCGGCAGCGACCGCAACCGGGTGAAGTCAAC
AGAGGAGGCGCCGCGCGGCGGTGCTCGTGGTGGCCGGGAAGCCCGTGTCCGTGGTGGTCGTGGCGGCCGTTTCCCCCGCG
AGCGCGATGACCGGCACTCGAAGGGTCTCCCTGGGTATGTATTTGCCTGTTCTGTGGCTTGGTATCGTGTTGCTGACCAA
GTAGTGCATCGGAGAAGCACGCCGGTGGCCACACTGAGGGCGATGCGGAGAAGCGGGACGAGGATGCTGGTGCGGCCATC
GCTCAGAGCGACGAGAAGGCTGCCGCGGTCGAGGATGCCGCTGCGGTCGACGAGGAGCCCGAGGAGAAGCAGGTGACGCT
GGATGACTACCTCGCCCAGCAGGCCGAGAAGAAGCTGAGCCTGGACGCCCAGCTGGCGGTGCGCCAGGCCAACGAGGGCA
CCAAGCTGGACAAGAAGTGGTCGTCGGCCAAGCCCCTGGTCAAGGAGGACGACGACGACTTCATCGCGGGCTCGAGCGGC
AAGGCCAAGCGCGAGCGCGAGCGGAAGGTCAAGCAGGTCATCGAGATTGACCAGCGCTACGTCGAGCCCGAGCGGCCGGC
CTTTGGCGGTGCACGTGGCGGCCGTGGTGGCCGTGGCGGCGCCCGTGGTGGCGATCGTGGCGGCGACCGTGGCGACCGTG
GCGACCGTGGCGACCGTGCTGACCGTGGCGACCGTGCTGAGCGCGGTGAGTTCCGCGGTGGCCGTGGAGGTCCCCGTGGT
GGTCCTCGTGGCGGCAGCCGTGGCCGTGGTGAGCCGCGCGGTGCCTTCCGTGGTGCCGCTGCTCCCCAGGGCGCGATCCG
GGGCGCTGACCTCAATCCCAAGGACGAGAACGCCTTCCCCAGCCTGGGCAGCAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62