GenePrediction:GLEAN_1228 Details

Name: GLEAN_1228
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1491085..1492255 (+ strand)
Length: 1171
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1491085..1491322 (+ strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_173:1491373..1491467 (+ strand)
Length: 95
Type: CDS
Source: GLEAN
Position: GCSC_173:1491596..1492255 (+ strand)
Length: 660
>GLEAN_1228 class=GenePrediction position=GCSC_173:1491085..1492255 (+ strand)
ATGTCGGCTTCTCTGCCCGGCAGCCGAGAGCTGCCCGCCTCGCAGTACGACCTCAACACATACTGGGGACGAGTCCAGCA
CACGGCAGGCATCACCGATCCCAGGACTCTACTGGTTGGCAGCGCAGGGCTGGAGCAGGCCAAGAGGGCCATCATTTCCT
ACAAGCAGGGCGAGGTCAAGGAGATGACGCCAGAGCTGTGGCAGGCCAAGAAGATTGTCGACTCGACGCTGCACCCAGGT
CAGTGAGAGAGAGAGAGATGGCCGGGTATCGAGCTGACAAGGCTACAGATACGGGCGAGCCGGTGCTACTGCCGTTCCGC
ATGTCCTGCTTTGTTCTGACGAATCTGGTGGTGACGGCTGGCATGTTGACGCCAGGTCTCGGGGTGAGTGGTTTGTGTTG
TGTTGTTTCCCTTGTGCCTTGTTCCTCTTCCTCTTCCATAAACGAACACACTTTCGCTCTGACTTCATCCCACCTTCTCC
TCGTACCAGTTTCCCCACGCTGACAGGTCAGACCACGGGCACGGTGCTGTGGCAGATTGCCAACCAGTCGGTCAACGTGG
CCGTCAACAGCTCCAACGCCAACAAATCGTCGCCCCTGACGTACGGCAAGCTGGCCCAGTCGTACTGCCTGGCCGTCGGC
GCCTCGTGCTCCGTCGCCGTCGGGCTCAACAGCCTGGTGCCGCGCCTGCGCCACCTCGCCCCGTCCACCCGCCTGGTGCT
GGGCCGCCTGGTGCCTTTTGCTGCTGTTGCCAGCGCCGGCGCCCTCAACGTCTTTCTGATGCGCGGCGAGGAGATGCGCA
CTGGCATCGACGTGTATCCGGTTGGCGAGGATGGGGTCGCAGCAGCGGCCGAGTCGCTCGGTCGCAGCAAAAAGGCCGCC
GTCCTGGCCGTCGGCGAGACCGCCCTCTCGCGCGTGCTCAACAGCTCGCCCGTCATGGTGATTCCGGCGCTGCTGCTCGT
GCGGCTGCAGCGGGCCGCCTGGCTGCAGCAGCGGCCGCGTCTGACGCTGCCCGTCAACCTCGGCCTCATCACGGCCACCA
GCTTCGCCGTCCTGCCACTGGCTTTGGCCGCGTTTCCGCAGCGCCAGAAGATCGCGGCTGACTCGCTGGAGCCGCAGTTC
CACGGCCGCGGCGGTGCCGGCGGCCTGGTCGAGTTCAACCGGGGCATCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62