GenePrediction:GLEAN_1229 Details

Name: GLEAN_1229
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1494903..1497498 (+ strand)
Length: 2596
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1494903..1495316 (+ strand)
Length: 414
Type: CDS
Source: GLEAN
Position: GCSC_173:1495542..1495961 (+ strand)
Length: 420
Type: CDS
Source: GLEAN
Position: GCSC_173:1496078..1496159 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_173:1496226..1496573 (+ strand)
Length: 348
Type: CDS
Source: GLEAN
Position: GCSC_173:1496640..1497099 (+ strand)
Length: 460
Type: CDS
Source: GLEAN
Position: GCSC_173:1497155..1497242 (+ strand)
Length: 88
Type: CDS
Source: GLEAN
Position: GCSC_173:1497304..1497498 (+ strand)
Length: 195
>GLEAN_1229 class=GenePrediction position=GCSC_173:1494903..1497498 (+ strand)
ATGTCGACACCGACGACAGCCACTGCGACGCTGCCTCAATATTCCAGCTTCCACCCGTTTTCACACCAGTCGTCCTACTT
GCAGGCTCTACCTGCTCCATATTCCCAGGTCTCGACCTCGACGGGAATCCATCTTCCTCCACCGGCAGCGATGACGAACG
GGGTGGCCGTGTCGAGCCATGCTCGGGCGCCGCTCTATTCCAGCAGCTCGTCGCAGTCGCACTACGCGTCTGTAAGAGAC
ATCGAAGGGCCAGGCCCAGTACACGGCACGTCCTTGGCCGAAAACCCGACACAGACCAGCACCACAGCCACGGCTGCACC
CTCACGGTCGCCCGAGGGTACGTTCTCGCGAAAACGACGTCGGTCTGGCCCTCCGGACTGGGAGTCATTTTACAAGAACG
GCCTGCCGCAGGAGGTGATTGTCATCGAAGACACGCCTGAGCGAGACGAACAGGCTGCATACGGCAGCAGTGGCGCTGCG
GTGCGCACTAATGCTCCTGCGGCTGTTTCTGCTGTTTCTGCTGTTTCTGCTGCCTCTGCTGCCTCTGCTGCCTCTGCTGC
CTCTGCTGCCTCTGCTGTCTCTGCTGTCTCTGTGTCGGCTGCTCCTGTCGCGGCTGCTTCCTACCACAGCGAAACGCAGG
CGGCCAACGTGGATGGAGAACAGCACTCGGCCAAAAAGCGGAGGCGGCTCGACGAGTCGCTGTCGACGACCAGCACGCTG
GTCGCGAGCGGCCGCTACGACCCCGTCTACAATTATCCTCAGCCCAGCGGGTCGACAGCGTCCAGCGAGCGGACCAATTC
CAACTCGTACGCCAACGCTGCCGCGACAGCCGCAAATACCGCAACGTCGTCGCTCGCGTCAACCCGTGGCTACCCGGCGG
CCTACGAGGCCACGGCTGCCAGCCAGAAGCTGAGGAGGACCACCCGCCAGCAGGCGGCAAACGAATCCAAGAAGAGAGAC
CCGGACATGACTGTGATGGGCCTTGCCTTTACTCACTATCGCCCACCTCCTCTTCCGCCCGTCAAGGCACCGGAGGTAGA
GGTCAAAGTGATCCATGACGTACGTTTTTTTTTGTCGCATCGCTTTTCGACATCATCTATCTACTGTTGTCGCTCTTGTT
GTTTTGTTTCCATTTCGTGTCCATCTCCATCTGTGCAGCCTACTGACATATGTAGGCACGTTACGACAAGAGCGTCAAGG
TCGACGACGAGGACGGCCATTACATTGTTGTGCCAGACGCCGACCTGACCGAACGCTGTATGTCTCCTGCCCTATACGCC
CGTTTCGATTAGCACACAGCCGCGACTGACTGATACTTTGCAGACCAATTGGTCAAGCTGCTCGGCCAAGGCACTTTCGG
CAAGGTCGTGCAGGCCCGTGATCGTCGGAGCAAGAAGCTGGTGGCTATTAAGATCATTCGATCTGTGCAGAAATACCGTG
ATGCGTCCCGCATAGAACTACGTGTTCTCGAGACGCTCAAAGCCAACGACCGGGAGAACCGGAACCGCTGCATCCACCTG
TTCGAATGCTTTGACTTCCGCGGACACATTTGCATTGTGATGGACCTTTTGGGCCAGAGCATCTTTGACTTTCTGAAGGG
CAACACGTTTGTTCCATTCCCCAACAGCCAGATACAGAGTTTTGCACGGCAGCTCTTCACCAGCGTTGCATGTGAGTGGT
GCACCTTGCTTAATCGCCATGTCCTTTTTCCCCTGCTGACAAGCCGACAACCTGCAGTCTTGCATGATCTACAACTTATC
CACACGGATCTGAAGCCTGAGAACATCCTACTCGTCGACGCAAACTACCAGACATTTACATACAACCGCAAAATCCCGTC
GTCTTCTACGATTGTAGCGCGGCAAGCCTCACAGCGAAGAGTGCTTCTGGACACGGAGATACGGTTGATTGACTTTGGGT
CTGCCACATTCCAAGACGAATATCACTCTTCTGTCGTGTCGACGCGCCACTACCGGGCGCCAGAAATCATACTCGGCCTC
GGCTGGTCGTTCCCGTGCGACATCTGGAGCATAGGCTGCATTCTTGTGGAGTTCTTTACGGGCGATGCACTCTTCCAGAC
CCACGATAATCTCGAACATCTAGCGATGATGGAAGCGGTGTGCGACTGCCGCATCGATGCGCACCTCGTACAGCAGGTGA
CCAAATCACCTCGACACGGAGGCAACCCGGCGTCAAAGTGAGTGCTGTCTTTCTCTTTCTGGCTGGCTGCTCTTGTATAC
TGACAGTTGCAGATACTTCAAAAGGGCCAAGCTTAACTACCCGACGACAGAAACGACGCGGGCATCCCGGAGATTTGTCA
AGGCTATGAAGAGGTTAAATGTGAGTGCCGGGTTGGACGGACGACAGGAGGCGGACGGTGTCGGCTGACCAGCTCGTGCA
GGACATCATCCCACGCAGCAATAATTTCTTGAAGCAGTTCCTGGACCTGCTCAAGCGCATTTTTGTGTACGACCCAGCCA
AGCGGATCACGGCAAAGGAGGCGCTGCTACACCCTTGGTTCCGGGAGGTGGCGCTTCAGGACGACGGGACGGTGGCGGCA
AAGATCCGGCAAGAGCGGGCGGCAGCGTCCAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62