GenePrediction:GLEAN_122 Details

Name: GLEAN_122
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:827963..830174 (+ strand)
Length: 2212
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:827963..827982 (+ strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_179:828044..828584 (+ strand)
Length: 541
Type: CDS
Source: GLEAN
Position: GCSC_179:828694..828774 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_179:828836..829479 (+ strand)
Length: 644
Type: CDS
Source: GLEAN
Position: GCSC_179:829817..830174 (+ strand)
Length: 358
>GLEAN_122 class=GenePrediction position=GCSC_179:827963..830174 (+ strand)
ATGACCAAGAAGAGGAACAGGTAAGCTGCTGATCTGAGCCCCCAACTCGTGGGCTTATAGGAGTTGTCGCTGAACTTATA
GGCGGGGCAGCAGCAGCACTGTAGGAAGACAGCCTCAACCACCCGACTCATCACTTGTGCAGGCGCCATTACCAAACTCC
GACGAGCAGCTACTGCTTGGAGAGGATTTGCTCAATATCCCGGGTTTATGGCCCGAAGACAACCTGAGATCTCAGGCCAG
TGCTGCCGGCATGGCATCTACTCTGCCAGAGGAGGTCTCGTCACGAGCAAACTTCCTCGAAGAGTCATTCGATCAGCTGG
ATTACGGGTGTCTTTCTGCATTGGACATATTCTCCCCATCTTCTTACATCCAGAGCTATACCTCCGGTACCCTTCCGTCC
GGACCGCCACTAGAGAATGATCCGGACAGTTCACCAACGAAGAGATCCTGCAGGCTATCTCATCTGTCCAACGACGACTT
GGACTACCTTGGCAAGAAGGGAGTCTTTGTCCTTCCACCTCTGCCAGCACAGGAAAGCCTTCTCAAGGCATACTTTCTAT
TTATCCACCCTTTCCTGCCTGTTTTGGCGGAAGATGAGTCTTGGTCTGAATACGAAGCTGAAGTGAAGAGCACCGGTCTC
TTGTTGTATAGGTCAATGTTGTTTGCGGCCTGCCCAGTGGGTTCCTTTGCATCACTTTCAGTTTTGCTCTTTTACTAATC
GTGGGCTCCAGTTCGTCTCGCCTGAGGTTGTCCTTCAACTGGGCTATAATACCGTCGCCGAAGCACAGGAGTCGTTATTC
GAGAAAGCCAAGGTAAGTCTGTCTGTCTAATAAGGCGCCCTGACATTCTCTTTTATACTAAATGATCGCACAGCTACTCT
TCGATTTTGAAACTGAGGATAATGAACTTGCACTCGTCGGCTCCGCTCTGTTGCTATCATATCGGTCGCCAAGGGCAGAC
CAAAAACTGGTCCAGAAGCCACTGTACTGGCTTGCTATTGCCATATCGTTGACTAAAGAAATATCGAACAACCGCGGAAT
ACAGTGTCCTGACTCCATGGGCTATAAGGGACTTGTCAAGCGTTTACAATGGGCTTGTGCTATTCGAGAATTGGTAATTG
CTCTTAGTTCTCGGAATATTACCGAGGTGGAGCCATGTCTACCTGAGCTGCCTGTGCTTGATGTTGAGGACATTGAAGAC
TCAACGATTCAATCTCGGGTCTATGATAAGGAAGCAAAGCTACTATTTATGGCGATGTTTCTCTCTCTCACGGAACTTAC
ACGATTGGTTGTCAAGATCCGCCTCCAAAAGTCTTCGACGGATTTTGGGTCGGGTGTAGAGCGGACAGCCAAAGATCAAA
ATGTGGAGTGTCTATTCAGTGTTGAAAAGGCGAGTCTTGAACTGGCGGCATGGCGAGACAAGTTCGCGAGGAAATTTTCT
CTCGAAACGACGACGTCAACTTTAGCCAACCTCAAAATGCTGGTGTTCCATCGAAATCTAGCTCTTTTGTTGTGCGAGTA
AGTTGTTTATCTGTCGCTATAGTCCATCTCGGAACTGACATACTAAACAGCTCTTTTTTGATAACCCTGAATCGGCCACG
GCAAGCTTACTTCAGCAACTCTTCGTACTGGTCACAGGGAATGGTCAACCTCCTCAAGGCGCAGTGGCAAAGAGCAAAGA
GTGCTGCAGCCGACATGACAAACCTGATAGCAGAAGTCAGAAATCTTGGCTTGGGCCCATACCTGCCTATAACAATGTAA
GCAAACGGCAGAAGACTTGACTCGGACAGATCAGAAACGTTTCGTACCAACGTCAGGGGCTTTATTCCAATTTTGTTCTG
ATGGTTTCTTTTAGGTCTCCCATTGCTATAAACTCTGGAATTGTTCATACATTGCAGCGGCCGCTATACGAGTTTACTCA
ATCTTCGGATAAGCAAGAAGGCGTCAAGCTCTGCATCAATGTGCTGGAGGAAATGCAACAGCGCTTTCCAGTTGTGAATG
ATATGATAGCTATGCTTTATGCTGCCATTCAATTCGCAGAGCGGGAAGTCGCAACCTACAGCCTGAACAACACATCCTCT
ACCGAGTTTGGCTGTGGGAAAGACCTTCTATCTGGCTCGGATCAAGAGATGATTGTTCGAGAGGCTTTCATCATCTCAAG
AACAATTCATTTTCTCGATGGGCTGTTCTACAAAGGCTATCACAATTCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62