GenePrediction:GLEAN_1231 Details

Name: GLEAN_1231
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1510611..1516451 (+ strand)
Length: 5841
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1510611..1510676 (+ strand)
Length: 66
Type: CDS
Source: GLEAN
Position: GCSC_173:1510748..1510770 (+ strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_173:1510854..1515539 (+ strand)
Length: 4686
Type: CDS
Source: GLEAN
Position: GCSC_173:1515596..1516451 (+ strand)
Length: 856
>GLEAN_1231 class=GenePrediction position=GCSC_173:1510611..1516451 (+ strand)
ATGTCGGAAATGAGCTCCAACCCGCAGCTGCAGCTACAGCTCGACGAGCTGGATAAGGAACTAGAGGTGCGTTTGCAGAA
CCAACGAGAACACCGACGACTAGTCCTTCTTGCTAACAACGGACCGCAACTGCACAGGAGGGCGACATCACACAAAAAGG
GTTCGTACGCGATGCCGCCGTCTGGCTCTGCTCTGCCTGTCCATTGCCGCCGATCCGTCTGCTCACATCTCGCCTCGCTC
CAGGTACAACAAGCGCCGAACCCAGCTGCTCTCACAATTTGGCCCTCTGGGCTTCTCCGACCATCGCGCCTCCATAGTAT
CACAAACTCCCTCCGCCGACGGTTCCGGCCAGGTCTCTCCTGCTGGCCATCGTGCTGCCTCCTACGCCGCTCTCAATGCG
ACCTCTTCCGCCGGCGGACCCTATTCCCAGTCGCTGAGCTCAGCGTCCGAATCCGGCCGACTCTCGTCTCCGAATCCGTC
AGCTCTGCTCGTCCCCGGAGGCCCCATTGCTGCCCAGCAGGCAGACTACTCCCGCGGCCATGATTCGCTCTTCTTTTCCA
CGCCGCAACCACCGAATAGCCGGCCGCTGGCACCGCCTGGCACCGCTAGCAGCGAACGTTCCCGGACGACGACCATGCTG
TCGACAGACTATGCCTTCAACCCGGACCAGCAGCAGTATGGTGGATATGCCGGTTCAGGGGCTGTCGATCCGCGCCTGCA
GAGCCTGCAGAGCATGCAGAATCCCTACGACAGTCGCTCCAACACGATGATGGATTCGCAGGCATACTTTTCCGATTTTG
CCGGCCAGCAGGCCTATGACCAGGGTCCAGCCGAGTATGGCGGTGCACAGCGCTATTCCGGGGCCGGCGAGCCGTTTTTT
GGCCAGCGGTATTCCACCGGCGACGCCTTCTCGCCAACCGCGGCCATGGCACCGCCCATGCTGACGACCCGTGACCTGCC
CCCTGCCGACGCCCTCGAACACCAGTTGCCCCTGGAGCCGCGGGAGGTACCGTTCGCCATCGACGACCCCCACGACAGCA
ATACGCCCATGTCTAGGTTTGACAACATCGCGGCCGTGCTGCGGCACCGCGGCCACATCATTGGCAAGAAGCCGGCGTAC
TGGGTGCTCGACAGCCGCGGCAAAGAAATCGCGTCCATCACGTGGGAGAAGCTGGCGTCGCGCGCCGAAAAGGTGGCCCA
GGTGATCCGCGACAAGAGCTCGCTGTACCGCGGCGACCGTGTGGCTCTGGTCTACCGCGATTCGGAGATTATCGAGTTCG
CCATCGCCCTGCTCGGCTGCTTCATCGCGGGTGTGGTGGCGGTGCCGATCAACGAGCTGAACGACTACCAGCGACTGAAC
CTGATCCTGACCTCGACCCAGGCCCATCTGGCACTGACGACGGAGAACAACCTCAAGGCCTTCCAGCGCGACATCACGAC
GCACAAGTTGACCTGGCCCAAGGGCGTCGAGTGGTGGAAGACCAACGAATTTGGCAGCTACCACCCGAAGAAGAGAGACG
ACGATGCCGCGCCGCTGTCGGTGCCGGACCTGGCTTACATTGAGTTCTCACGGGCGCCCACGGGCGACCTGCGCGGCGTC
GTGCTGAGCCACCGCACCATCATGCACCAGCTGGCCTGTCTGAGCGCTGTCGTGTCCACGGTCCCGGGCAACCAGCCGGC
CGACACGTTTAACGGCTCGCTGCGCGACAAGAATGGCCGGCTGATCGGTGGCGGCGCCAGCAGTGAGATCGTGCTGTCGT
ACCTGGATCCGCGTCAGGGCATCGGCATGATCCTCGGCGTGCTGTTTGCCGTGTATGGTGGCCACACCGTCGTCTGGATG
GAGCACAAGGCCACCGAGGTGGCCGGTCTGTATGCCCACCTGATCTCCAAGTATCGGGCGACGCTCATGGTGGCCGATTA
TCCCGGCCTGAAGCGGGCAGTGTACAACTACCAGCAGGACCCGATGACGACGCGCAACTACAAGAAGGGCATGGAGCCCA
ACTTCCAGGCGGTCAAGCTGTGCCTCATCGATACGCTGACGGTCGATCCCGAGTTCCACGAAGTCCTGGCCGATCGCTGG
CTGCGACCACTGCGGAATCTGCACGCCCGCGAGGTGGTCGCGCCCATGCTGTGCCTGCCTGAGCACGGCGGCATGGTGAT
CGGCGTGCGCGACTGGCTCGGCGGCGAGGAGCGCATGGGCTGTCCGCTCAAGCTCGATGTCGGCGATGGCGCGAACACGG
GCGAGGGGACGGTCGATGCGAGCCACACAAGCGACGGGGCCGCCTCGACCGACGGTGCCGACCAGCCGGCTAACGGATTC
GACACGCTGCTCGCCGGCGGCGGCACGACCAGCAAGAAGGAGCGGCGGGCCAAGAACGAGCTGAGCGAGGTGCTGCTCGA
CAGCGAGGCGCTCAAGACGAACGAGGTCGTTGTGCTGGCCGTCGGCGAGGAGGCGCGCAAGCGGCAGAGCGAGACCGGGA
CGGTGCGCGTGGGAGCCTTCGGCTATCCCATCCCCGACGCCACGTTGGCGGTGGTCGACCCGGAGAACTGCCTGCTGTCA
TCGCCACACACGGTTGGCGAGATCTGGGTGGACTCACCTTCGCTCTCGGGCGGCTTCTGGGCGCTGCCCAAACACACGGA
GCAGATCTTCCACGCGCGGCCGTACAAGTTCGAGCCCGGCCACCCGACTCCGACGGCGGTAGAGCCTGAATTTCTGCGCA
CCGGTCTTCTCGGCACGATCATCGAGGGCAAGATCTTCGTGCTGGGCCTGTACGAAGACCGGATCCGGCAAAAGGTCGAG
TGGGTGGAGCGCGATGCCGAGGTGGTCGAGTACCGATACTTTTTCGTGCAGCACATTGTCTTCACCATCATGCGGTCGGT
GCCCAAGATCTTTGACTGCTCGGCCTTTGACGTGTTTGTCAACGACGAGCACCTGCCGATCGTGCTGCTGGAGACGTCGG
CGGCCTCGACGGCACCGGCGACGCAGGGCGGCCCGCCGCGACAGCTGGACACGGCCCTGCTCGACTCGCTGGCCGAGCGC
TGCATGGACGTGCTGATGCAGATACAGAACCTGCGGGTGTACTGCGTGATGATCACGGCGCCCAATGCACTGCCGCGCGT
GCTTAAGAACGGCCGGCACGAGATTGGCAACATGCTGTGCCGGCGCGAGTTTGATCTGGGCAACCTGGCGTGTGTGCACG
TCAAGTTTGCGGTAGAGCACGCAGTGCTCAACCTGCCGTTTGGCGTGGACCCGATCGGCGGGATCTGGTCGGGACTGGCG
TCGCACTCGCGGGCGCAGATTCTGCAGGGCGCCGACAACCAGTACTCAGGCATCGATCGGCGCGAGGTGGTGATGGACGA
CAAGACGTCGACGCCGCTCAACAACTTCCTCAGCATCACGGACCTGATCCAGTGGCGGGTGGCGCGCCAGGCCGAGGAGC
TCGCGTACTGTACCATTGACGGACGTGGTAAAGAGGGCAAGGGCATCACGTGGAAGAAGTTCGACACGCGGGTGGCAGCC
GTAGCGGTGTATCTGAAGAACAAGGTGAAGCTGCGGGCGGGCGACCATGCGGTGCTGATGTACACGCACTCGGAGGACTT
TGTGTTTGCGGTGCACGCATGCTTCAACCTGGGCATCGTGGTGGTGCCAATGGCGCCGATGGACCAGAACCGGCTGTCGG
AGGATGTGCCGGCGTTCCTGCACCTCGTATCGGATTATACGGTCAAGGCGGTGCTGGTGAACCAGGACGTCGACCACCTG
CTGAAGATCAAGGCAGTGTCGCAGCACATCAAACAGTCGGCGCAGGTGCTCAAGGTGGCGGTGCCAGGCGTGTACAACAC
GTCGCGGCCGTCGAAACAGAGCAGCGGGATGCGCGACCTGGGACTGAAGATGGATCCGGCCTGGGTACAGCCGGGCTTCC
CGGCGCTGATTTGGACGTACTGGACGCCGGACCAGCGGCGCGTGGCGGTGCAGCTGAGCCACGACACCATCCTGGGCATG
TGCAAGGTGCAGAAGGAGACGTGTCAGATGACGAGCTCGCGGCCGGTGCTGGGCTGCGTGCGCAGCACGACCGGACTCGG
TTTTGTGCACACGTGTCTGATGGGCATCTATATTGGCACGCCGACGTATCTGCTGTCGCCGGTGGAATTTGCCCAGAGTC
CGATCTCGCTATTCCTGATCCTGTCGCGGTACAAGATCAAGGACACGTATGCGACGCCGCAGATGCTGGATCATGCCATG
GCCGTGATGCCGGGCAAGGGCTTCACCATGCACGAGATGAAGAACATGATGATTGCGGCTGAGGGCCGGCCGCGCGTGGA
CGTGTTCCAGCGCGTGCGGCTGCACTTTGCCACGGCCGGTTTGGACCGCACGGCCATCAACACGGTATACTCGCACGTGC
TGAACCCGATGATCGCGTCGCGGTCGTACATGTGCATCGAGCCGATCGAGCTGTGGCTGGACACGAAGGCGCTGCGGCGC
GGCTTGGTGCTGCCGGTAGACCCAGATACGAATCCACGGGCGCTGTTGGTGCAGGACTCGGGCATGGTGCCGGTGTCGAC
GCAGATTGCCATTGTCAACCCGGAGAGCCGGTTGCTGTGTCTGGACGGTGAGTATGGTGAGATCTGGGTGGACTCGGAGG
CATGTGTCAAGGCGTTTTACCGCTCGCGCGACGCCTTTGACGCGGACCGGTTCGATGGCCGGACAGCCGATGGTGACCCG
ACAATCCAGTATGTGCGCACCGGTGACATGGGCTTCTTGCATAGCGTCAGCCGGCCGATCGGGCCGAGCGGCGCATTGGT
CGACATGCAGGTGCTGTTTGTGCTGGGCAGCATTGGCGAGACATTTGAGATCAACGGGCTCAGTCACTTTCCCATGGATA
TTGAGAACTCGGTCGAGCGTTGCCACCGCAGTATTGTGCCCGGAGGATGGTGAGTTTCTGTCTGCTGCTCTGTTTTCCGG
TTTCAATCAAGGCTAACCAAGACAGTGCTGTGTTCCAGGCTGGAGGACTGTTGGTTGTGCTCGTCGAGGTGGCACGCAAG
TCGTACCTGGCATCGATGGTGCCGGTGATTGTCAACGCCATCCTCAACGAGCACCAGGTGGTGGCAGATATTGTGGCGTT
TGTCAACCGCGGCGACTTCCCGCGGTCGAGACTGGGCGAGAAGCAGCGCGGCAAGATCCTGGCCAACTGGGTGTCGCGCA
AGATGCGGACGATGGCGCAGTTTGCGATCAAGGACGGAGACGCTTCGGAACACGACGCATCAGGCGGCGGGCTGGAAGCA
CACCGGACGAGTATCAACAGCGTGCGCAGCTCGGGCGGCGGGATTGCGAGCGTGCGGAACCTGGACATGACGCCATCGAC
GCCGACGCCACCGCAGATCCTAGAACAGCGCGAGCTAGAGCAGCAGCATGAGCATGGTGGCGGCCAGAATGGTCGTCGCG
TCAGCAGCGGCTACTATGGAGGAGGTTATGCAGCGGGCGGTGCGATTGAGATGCCGGCAGACGAGGTGGCGTATGGCACG
CAGTATGGCGACGGTGGCGATGAAGACAGCAACGATGGCAGCCGGCGGACTCCGACACAAGCCCGCATGGACTCGCTAGG
TGGTGGCAGCAGCTTTGAGCGGCCGCCGACGGTTGGATCGAGTGGTGGTGGTAGTGGTGGTGGTGGGTGGCAGCTGCCGC
CGCAGATCATGCTGCCCGGCGTGGACGGACGGCCGACGACGAGTGAAGAATGGCGAATGGGCGGTCCCTTGGGTAGCCGG
TCGAGTGAGGCCGAAGGGGACTGGGCGCATGAGGCGATTATGGGGATGAATCTGGCAGACGACCTGAACGGGAAGATGTG
A

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62