GenePrediction:GLEAN_1232 Details

Name: GLEAN_1232
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1529513..1530757 (+ strand)
Length: 1245
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1529513..1530245 (+ strand)
Length: 733
Type: CDS
Source: GLEAN
Position: GCSC_173:1530444..1530757 (+ strand)
Length: 314
>GLEAN_1232 class=GenePrediction position=GCSC_173:1529513..1530757 (+ strand)
ATGGCTCCACCGGTCGAGATCTCCATCCCGACGACGTCAACGGCCCCTGCGTCGGCTGGCACGAAGCCGTACACGCTGTA
CAACATCACGCTGCGGCTGCCGTTGCGCTCGTTTGTCGTGCAGAAGCGCTACACCGATTTTGCCATGCTACACAGCGCGC
TGACGGACCTGGTCGGCGAGGCCGCGCCTGCGCCGCTGCCGGGCAAGTCGTGGTTCCGCCGGACCGTAGACTCGCCCGAG
CTGACGGAAGAGCGCCGGGTGAGCCTGGAAGCGTACCTGCGCGCAATTGCAGAGTCGCCGGACCGCCGGTGGCGCGACAC
GAGCGCCTGGCGGGCCTTTCTGAACCTGCCGAGCGTCGTCAACGGAAGCGCGGGCTCGACGGCGAGCGGCGGAAACACCA
ACGGCAGCTCGCTCGAGTCTCGGCTGCCGGCCATTGGCCTGACGGCTGCCAATGCCGCCGCTGCCGGCGATCCCGGCACC
TGGCTGGACCTGCACAAGGAGATGAAGAAGGCGCTGCACGACGCGCGACTGCAGCTGGCGCGACGCGATGCAGCAGCGGA
TGCCGTGTCTGGCTCGTCGGCGGCGGCCGGCTCGTCGTCTTACGCCGCCATCGCTGCCGGTGCAGCCGCCAAGCGCGAGC
TGGTCAAGGCCGGCAGCCTGCTGGCCGCCCTGACAACTGGGCTCAAGACGCTGCAGGAGGCCAAGCGACTCGGCGACGGC
GAACTGCGGCGGCGTCGCGACCTCGTGGCGGCGGCACGCGTCGACAAGGACGGCCTCGAGACGCTCAGCGCGAGCCTGGC
CAGCGGGCGTAGCGGTGCTGCTGGTGGCGACGGTGGCAGTGGTCCTGGTGCCGCTGTTGGTGCTGGCAGCAGCAGCAGCA
GTGGGCGGATGGGACCGCCGGAAACTGGCGCCCGCGCTTCGCTCTTTTCAGGGGCTGCCAGCAGCAATGGCCGGGGGGCT
GCCCGGGCTGGCGGCCGCGTGCTCGGAGCTCCACTGCCGGAGACGGATCGGACACGCGAGCGCGACAACAACGGCGTCGT
ACAGCTGCAAAAACAGATGATGGCCGAGCAGGACCAGGACGTCGAGGCGCTGGCGCGGATCGTGCAGAGACAGCGCCAGC
TCGGACTCGCCATCAAGCAGGAGGTCGACACGCAGATCGGCATGCTCACACAGCTGGATGAGGACACGGAGCGCGTCAGC
AACAAGGTCAGGGTGGCCAAGGAGCGCACCAGACGTCTAGGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62