GenePrediction:GLEAN_1233 Details

Name: GLEAN_1233
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1531878..1532858 (+ strand)
Length: 981
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1531878..1531891 (+ strand)
Length: 14
Type: CDS
Source: GLEAN
Position: GCSC_173:1531952..1532023 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_173:1532131..1532243 (+ strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_173:1532323..1532858 (+ strand)
Length: 536
>GLEAN_1233 class=GenePrediction position=GCSC_173:1531878..1532858 (+ strand)
ATGGGCGAATCACGGTAGGACTTGCATAGCCGGTATTGCTTCGTGGAGTTTCGTTGCTGAGACCCGACCTCCAGACAGGA
ACTCATCCAATGGCTGAACAGCCTGCTCCAGCTCAACATCACCAAAGTCGAGCAGTGTGGAACCGGGTGCGTGGTGGCAT
GGCAGGGCCTCTTCCTGTTTCCCCCTCTGATGCCCGTATGTGTATCGTGAACGTATAGCCACTCAAGCTGACCGCAAACA
ACGTCGCCTGCAGAGCTGCCCTTTGCCAGGTCTTTGACAGCATCTTCCTCGACATTCCCATGTCCCGGGTTAAGTTCAAC
GTGAACACGGAATATGCCTATATAACAAATTTCAAAGTTCTACAGAGTCAGTCGATCCGAGCAGTGAAGGGGGAAATATA
TGCGTGGAAGGCTGGCTAACCGCAACCTGTTTGTTCTCGCTGCAGACTCGTTTGCCAAGCACCAGGTGAACAAGCCGATC
CCGGTCGAGGCTCTGGTCAAGTGCAAGATGCAGGACAATCTCGAATTTCTGCAGTGGTCCAAGCGGTACTGGGACCAGCA
CTACCCTGGCGGCGACTACGACGCGGTCGCACGGCGAAAAGGCGCCCCTGTCGTCTCGGGCGGCGGGTCTCGGGCGACCG
TGTCGGCGGGCGCGCGGAGGACCGGCAGCACGCCGCCAACGACCGGTCCACGGCTGGGCAAGACCGGCGGTATCGGTGGC
GGCGTGGCCAGCGCGGCGCTGCAGCAGGAGAACGCCACGCTCAAGGAGACCGTTGTCGGGCTGGAGCGCGAGCGCGACTT
TTACTTTAGCAAGCTGCGCGACATTGAGCTCCTGATCCAGCAGGCCGTCGAGGAGGACCCGGAGCTGGAGAAGCAGGAAG
ACGGCTTGATCAAGCACATCCAGAACATCCTGTACTCCACCGAGGAGGGTTTCGAGATCCCGGCCGAGGAGGCCGCAGTC
GACGACCAGGAGACGTTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62