GenePrediction:GLEAN_1234 Details

Name: GLEAN_1234
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1542385..1542935 (+ strand)
Length: 551
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1542385..1542540 (+ strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_173:1542624..1542779 (+ strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_173:1542843..1542935 (+ strand)
Length: 93
>GLEAN_1234 class=GenePrediction position=GCSC_173:1542385..1542935 (+ strand)
ATGTCGAGGAAGGCCGTACTAACTACGGATGCACCCCCGCCCTTGCCACAGTTCTCGCAGGCTATCAAGTGTAATGGCAT
GATATACTGTTCGGGAAACATCGGTGTCGACCCGGCGACGAATAAACTTGTCGACGGAGGAATCAAGGCTGAAACGGTGA
GCCCCCACCAAGCTACCAATCTTTTCTGCTTCCATTGAAATGCGAAGCCATCGAACCGGGCGACTGACCAATCAACAAGC
GCATGGCACTCGGCAACCTCTCTGCAGTGCTCCGAGCTGGTGGTGCTAGCTTGGCGGACGTTGTCAAGGTCAACGTCTTT
CTCACAACAATGGACGATTTCCAACATTTGAATGAAGCCTACGACGAGGCGTTTTGCAACACCGTGCCTAAGCCGGTAAG
TCGCCGCCGCATAACTGCGCGAGGGTGATCTGAGCGTCATGTTGATACGTATCCATAGTGCCGAACTGCGATTGCCGTTT
ACCAGCTTCCTCTGGGGGCCAAGGTCGAGATAGAGTGTTCGGCCATCCTTCCGCCCCAGGCAAAGATATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62