GenePrediction:GLEAN_1235 Details

Name: GLEAN_1235
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1544756..1551620 (+ strand)
Length: 6865
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1544756..1544920 (+ strand)
Length: 165
Type: CDS
Source: GLEAN
Position: GCSC_173:1544987..1546304 (+ strand)
Length: 1318
Type: CDS
Source: GLEAN
Position: GCSC_173:1546365..1546606 (+ strand)
Length: 242
Type: CDS
Source: GLEAN
Position: GCSC_173:1547356..1547388 (+ strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_173:1547964..1549296 (+ strand)
Length: 1333
Type: CDS
Source: GLEAN
Position: GCSC_173:1549417..1550012 (+ strand)
Length: 596
Type: CDS
Source: GLEAN
Position: GCSC_173:1550074..1550670 (+ strand)
Length: 597
Type: CDS
Source: GLEAN
Position: GCSC_173:1551004..1551081 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_173:1551339..1551620 (+ strand)
Length: 282
>GLEAN_1235 class=GenePrediction position=GCSC_173:1544756..1551620 (+ strand)
ATGTACACCACATCATTTGCCTTTTTTGAGGCCCTGTGGGATGCCGGCGTCTCCCACTGCTTTGTCAATCTGGGCTCGGA
CCATCCCAGCATCATCGAGGCAATGGTCAAGGGCCAAAGGGAGCGGAAAGGAAAATTTCCCCGCTTCATCACTTGTCCTA
ACGAGGTACGACGACCGGTGCATGTGTTGGGAATATGCATGACCTCTACGACGAGATACTAACCAGTCTAGATGGTCGCT
ATGTCCATGGCAGATGGATATGCCCGTCTGACCGGCAAGCCACAGTGCGTGATTGTGCACGTGGACGTCGGGACGCAGGG
ACTCGGTGCTGCCGTGCACAATTCCAGCACTGGACGTGCACCTGTGCTGGTGTTTGCTGGGCTTAGTCCGTTCACCCTGG
ACGGCGAGCTGCGTGGCACGCGCACAGAATACATCCACTGGATCCAAGATGTGCCTGACCAAAAGCAGATCATCGGTCAG
TACTGCCGCTATACTGCCGAGCTGAAGACTGGCCGCAACGTGAAGCAGATGGTCAACCGCGCCTTGTCTTTTGCACGTTC
CGCACCGGCTGGACCGGTGTATCTCTGCGGCGCACGCGAAGTCATGGAGGAGGAGATTCAGCCGTACGAACTGAACCAGG
ACCACTGGAAGCCAGTTCAGCTTGGCGGATTGCCGGAATCATCTGTGGAGGACATTGCTGAGGCACTGTCCAAAGCCAAG
GAGCCGCTTATCATCACTGGCTACTCTGGACGCAATCAAGCTACGGCACCAGCTCTGGTCAAGTTGGCAGACGCAGTGCC
GAAACTACGCGTATTGGACACGGGTGGCAGTGACATGTGCTTCCCAGCGAATCATCCGGCGTGGCTGGGCCTCCGATTCG
GAAATCACGACGCTATTCGCACAGCCGACGTCATACTTGTGCTTGATTGTGACGTGCCCTGGATCCCAACCCAGTGCTCT
CCACCTACGGATGCCCGTGTTTTCCACATCGACTGTGATCCTCTGAAGAGGATGATGCCAGTGTTCTACATTGCAGCCGA
GCAGCGGATATTGGCCGACTCACTGGCTTCTATCGAGCAGATCAGCGCCTATCTGGAGAAGTCGGGCCCGAAAGTCGATG
CGGAAGCGAAAGAAGCTCGGGTCCAAGCCCACAAGGCGCTCCTGGCGTCTTATGAAAGTAAGGCGAAGCCGCTTGCGGAC
GGTGGATTTGGTGTTGGGCACTTGACTCGCGTCCTGCGAGACACATGCCCTACCGATACGATCTGGGCCATTGAAGCAGT
CACCAGCACTGGATTTGTGCACGATAATCTGCAGCCCAGCCTCCCAGGACAGTGGATCAACTGTGGTGGAGGTGGTTTGG
GCTGGTCTGGTGGCGGTGCTTTGGGCATCAAGCTGGCCACGGATTATGAGAACGGCGGACCGGGCAAGGGCAAGTTTGTT
TGCCAGATTGTTGGCGACGGAACCTTTCTCTTTTCGGTGCCAGGAAGCGTGTACTGGATTTCTCGGCGCTACAACATCCC
CGTTTTGACGATTGTGCTGAACAACAAGGGTGAGATCAGAGCCATCTTTAATCCAGGTTGTTGAGTATGCGCTAACAGTT
TTGCTCCAGGTTGGAATGCACCGCGACGGTCTCTTTTGCTCGTCCATCCAGATGGCCTGGGAGCCGGGGCGAGCAACGAA
GAGATTAATATTTCATTTGATCCATCGCCAGACTACTCTGGCATAGCCAAGGCTGCCGCTGGAGGCAACTTGTTCACTGC
ACGAGTAGATCAGACAAGCGAGCTCCAGGCCGTCCTGAAGCAGGCTGTGGACTCTGTACTGAGTGGCCAAAGTGCAGTTA
TCGACATCAAGGTAGCTCCTGGATGCTAGCTGCGTGTACTCTAGCTAGGCCACTACAAATCACCTACACATACATCGAGC
ACGTGATCATCGTGCTCTAAAAAGATGAAAAGATGGAAGAAAAAGAGCGCTAAAAGCTTATATCGTGATCTCTGCCGTAA
AGAAACTGAATATTCATCACTGGATATGCGACATCTATTTTGTGAGTTGTTCCATACGGGTTTGAAATATTCCATAGCTT
CCGTTTTATCTCCTGTCGATTTGCCAGCTCGGCACCGTTCGAAGTAATCAAGATACTTTCTGATTTTTAGATATGTGGAT
CAGTGACGACCTCTCAACCTGCAGGTAGCAAGTAGTAGCGCATATTATGCGGCCTTAACATAAGCTCTGACGACCGCTGA
ATGGTTGAGAACACAGATCACCTTGCGCAGTGGTGTGCTTTTCGCATATTGTGGTTGCTATAATCATAGCCACGCTGACC
TGGACGACGTGTTCGAATGTGACCGTATAAACTGCCCGTGCCGATGCACACAAATATCATGCAGTCTGGCAACTAGAGCC
AGTTGTCCTTCGTGTGTCTTTTATGATAAGCTGCTAGCTCTTAGATGGCCTTACTCAAGTAGATTCACGCCCAATACCAC
CGTGGGGCATTGGTTTGGTCAGCTGAAGCAATTTGGTATCCGCCCTTGTTTTGGATTCCTTTAGCTGCTGCAATGATAAG
TTCTAGCACCTTTACGGAGTACTGGCAACCTGCTTTCTAGATTGATCGCGATGGGTTACTGCTGGCTGGGATGGTACGTG
GCAGATTTGGGCTGCATATTTATCGAAAGTATCTCGCTTCTGGGAAATGTCTTTCAGGAGTTTGCGATCTCGATTTGCAC
TTTGGTTCATACGGAATTGCAAATTTACAACTAGATCTTGCGGATGATTTCGTGCATGCAAAACGTTTCACGCAAAGCTT
CAGACCCGTCGTCTGTAAGAAAGCCAATCAACAAAGGACTTCGCAACAATACGGACGAGCCAGGGTTGGGCTAAACACCT
GATGGGGCTTTTTAAGAGTTTATTAAAAAATCACCTTTACGCTGAGGACTCCACCTATCAAAGATCTATATGAGGGAGAC
AATCCACTGGAATCAATCCCAGTAAAACATAAGCAGCAGAACCGATTTATTCCCTCGTAACCTTTACGTTGGATTATCAC
CTCAAATCGTTCTATGCAATATGAAATAGGGCCTGGACCCGCAATCTGCCTATTTTGTGGACGAAACCAGCAGCTACACC
ATCAAGACAAGCAACAAAAACGGTAGCGACCATGAGCCGTGTAAGTGATTTAATCGCGTAGGAAGGGAATTAGACTGACG
TACAACAGGCGATCAGATATTGGAAGGAGGAGGACGTAGAGCCGTGGTCAGCTCTTGACTGGGAAACCATCAAATCGTTT
CTCTGGATTGGTTACGATATCTGCTGGGCCAAGAGTCTGCAGCAAGGAAATGAGTACATCACCAAGGGCATCCAGAAAGA
CGCTCTTGAAGACGTTACTATCATCTACGAATTTCTTCCACAACTAATCTGGACCCTGATGCAAGAAAAAAAGATCACCG
TAACAGAGGAAGCGCCACACCTTCGACCACCAGAGTTCGGCGAAGTCCACAGAAATTTGTTCCTATGCCTCGCAAGCTAC
AGCAGGAAGCTCGACCAGAGCTACCCCGAAAGGATGGAGGCTTGGCAGCAGGTCGACAGATGTCTGCAGAGAAACGGATT
CGACAAGCTGGAAAACCAGAAAACAATATGCGAGGCCGTTTACAATCGCTTAGCCGGATTCATCAAAGCGCGAGATGGCT
TTAATGCCATGATTCTTACAAAGGCCTATATGGATGTGGATCATCGTGCTGAGAATGGGGGCTTTGCTAAAAACAACTGC
AGAAGCATCCCTGCCTCTGAAGTTTCACCGCAGATGTGGCTGGTGAACTTTGGGTCAAACGACACAGAGGCAACGCGATC
CAAGAAAGCGCAATGCGGTGTCAGGGTTATCTTCCTGATGGCAGCTGGGGAGACGCCTCGCAAGTCACTACCACAATGGT
CTCAGTTTGGAACTCCGTACTACTTGATCAAGGGAACGACAGTGAAGTTGCTGAAGCCAGTTGAGACTGGAGGTATGGTC
TCATTTCAGTCTTCCTACTGGGAATGGAATACATCGCGCAGTGTTAGCGACAACACAACACTCAACCTTCACAACAATGC
AGGCGATTTTTTGCTTCACATATCACTGCGCCAGTCAAGGAATACTGTCGTGCTCAATAGCCGGCATGTCGACGGAAACT
GGGGACCCGACGAGGTTTTCCAGTTGAGAGACACCTTTGTTGGGTCAAACTACAGCATTTCCGTTCGCATTCATTACGAC
GGCTACGAACTCCTCTTCAGTTACCAGCCCGCTGCATACTACAAACGAAGAATTGCGGGAGTCGTGTCTTCTGTCTCGTA
CAACGCGAATACCGCCAACTATTCGCCGCTCTCGGAGGCACTGATAGTTTCAGTTTTCGACTCTATAGAACAGTTGACCC
AGACCAACCAGCTTGCCAACTGTGAAACCCCGGGAGACTCCTACGGAAGACCGAACGCGCGTACCATAACGACACGGCCT
GCGTTTAAACGTGGTGCCAGTTTTGCAGCGACGCCTGGGAAGATGACGAAGGACAATCTCGGTAAGCTAACATACTACTA
AGGCATCCTGAGATAGAGGCGGTAGATGCTAACAGACTAAAAAGGCTTTGAATATGCGGAGCACTGCTACCTTGGAGACA
CTATTACCCTGACTCTTCAAGATAAGAGTACTGTCACGGCCAAGGATCACGCTTTCATTCTCGAGAACCAGTTGACTGTC
ACATACGGCCAAATCAGCAGTCTCGCGGGAGACTTCTACGGAACCCACGAGCCCATCAGCGATGGCTTTAGCGACGAGGA
CCAAGCCGACCGCTTCGTCAAAGCATACAATACGCTCGCTTCCCGCTATGCAGGCCAGCCAGCAGAAGCCATCGAGATCC
TCAAGATCATGAAGAAGGAGATCAGCGCTGTCAACGATGCCATTGCTAACCACGAGAATCCATCCGAAGCGTACAGCAGT
CTTCCTGACGAGACCTGGGCCTATGAGAAGCTGACGATGTTTCGTCGGGGACAGCCGAGCTATCTTGGGCTAGCCTGGCG
CAACTGGGACCATTTCGGCGAAGATGCTCGAACAGCGTATAACGCCGGCCATTCGAAAGCTCTCGAGGTGGCTATCGCTG
GGGACCTTGAGAAGGCATATGCTATGAACGCCTTTGCCGATCACTTCTTGGAAGACTTGTTTTCGGCAGGTCACCTCAGA
ACTCCACGTCGTTTGTTGCATTCAGACAAAGTGTCCATACCGGACTATTGTGCCAAAGTAAGAATTCAACCTAGATCAGA
ACAGCTGAATACGACCAGAAGAGCTGACAGTTTCAAAGCTCATGTACGACGAAGACAATGCCATCGGTCTCTCCGTCACC
AACCCCAACGGTGAGACATGGACTGCTTATGGCGATAAATCCGGCCTCGACCCAGAGAACGACGAGAACAAAAGGCGCTG
CGTGAAGGCGCTGCAGACGTCCGCTAACGAGGTCTACATGGCTTGGAAGAAAAAGAAACAACCCAGCAGATACAGCTACG
GAGCATGGGCGCACGCACCAACTCTGGAATCCGCACAAGGAGAACAAGCCCTGGCGCCGCTTATACGCGATGGGAAGAGG
CGCGCTGCAATACGGAAGCGAGGGGCCTGGTCGTTTACCGAAAGCTGGACGTGTGCTGGAACGGCTCTCGAGTGCGCCAA
CAGCGGCTGGTGGAGCTACCCCATCACCATTGACGGTACGTCGGGGCCCCTGCGTGGAACTGACATCGCCGTCACTGCGA
CAGACTCAATGAAATGCAAGGTCTACTACCAAGATGCTCAAGGGGTAATTTGCGAGTACGTCAACGACAGCGGCTGGTCG
GTCACAACTTCGCCGACGTTCAGCGCCAAAATGTTCAGTCCTCTGGCTGTCGTCAGCTTTGATTTGGGCAAGCAGGTAAG
CAATATTTTATTTAGAATCCCGTCTTCGTTAATTCTCTCCCCGAAACGAGAATGTTTCTAAGCAAAATTCACAAACCAGA
TTCACGTTTATTGCGTCTCGGACGAAGACTATCTTCAGGAATGGTGCTGCTCAAATGGTCGTGACTGGGAAGCTGGAGAC
CTTACTAAATCAAAGATTCGTGTTGCGGCGAATACAAAGCTTACAGCAGTGTGTTGGTCCAACGGGGGACCGAATATCAG
ACTCTATGCGCAAGGTATGGTGCGGCAGAGAACCCCCTGAGATTGCACATCTGACAGAAGTGTAGAACCGCATACGGATA
AAATTCAGGAGTACTGCTATAACGCCGCATCTTGGGTGAAGGGTGCCGTACTCCCGCTCGCTCACACGGGGACCAGTCTG
GCCGCCGTATGTTCGCAGGATGGAACCCATATTCGGGTGTACTACCAGGCTCCCAACAGGACTATGAGAGAGCACTGTTG
TAATGGGGGTTGGTCGTCAGGTAAGCAGGTTATTATCGTTATTAAAGGGTCACTATCTACTTTACTAAGTCAACCACAGG
TAAATTTCACACCGATAAAATGCCCCGTCGTTCTTCAATCGCGGCTGTCGGATGGCATGACTCGAGAGAACGGTTGCGTG
TTTACTGCCACAACTCCCGAAAGAGCATCACGGAATTTAGGTGGAATGGAGAGTGGACGTCGGACGGCACAGTCCTCGAG
CCCCTAGAAATCGGGAGGTGTACCGCGGCCTTCCAGTGGGATGGTGGAAGCTGTATACGGTTTTATTATCAAGGCGATGA
TGACGGGCTGTGGGAGCAGTGCCAGAATCAAGACGGGCCGTGGTTTACGGGAGCTTTCAACAACGCTACAGGTGGTCGTA
GGGGAGTGGACAAGGCTCGCAGGACGATCCAATATACTGCTGATGAAAATGCCGAGAGAAACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62