GenePrediction:GLEAN_1239 Details

Name: GLEAN_1239
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1559231..1560795 (+ strand)
Length: 1565
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1559231..1559341 (+ strand)
Length: 111
Type: CDS
Source: GLEAN
Position: GCSC_173:1559406..1559443 (+ strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_173:1559616..1559641 (+ strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_173:1559850..1559970 (+ strand)
Length: 121
Type: CDS
Source: GLEAN
Position: GCSC_173:1560042..1560098 (+ strand)
Length: 57
Type: CDS
Source: GLEAN
Position: GCSC_173:1560159..1560795 (+ strand)
Length: 637
>GLEAN_1239 class=GenePrediction position=GCSC_173:1559231..1560795 (+ strand)
ATGACCGACGTACCTACCACGAGCGCGACTTTGGCTATGGCCTTGAGTCCGATTCCAGTCGCCGTTGCACAAGGCACCAC
TGAAGAGGAGGAGGCAATTCAGGTTGATGACGTGGGTCGATTTTACTACAGCCGCTGATGTGAGCCCTAGCCGCAGACAC
TCACTACCCCTCTAGGAACGTGACGATGACCCGGGTTACGATGACGGTTCTTCGTAAGTGTTGGTGTCGATAGGTTGGTG
AAACATTTCTGACCATTTCATTAGTCAGGCATCTAGCAGTTTTGTCTCGTCCTTGAACTCGAGCATTATGAATTACAAGT
ATATCGCATTGGGGCGCTATAAATGACTACAGTCTGTAGATAATCAATGGCTAATCGTTTCAAAGATTTCAGGTCCGTCC
TCTGAACCGACGTGCAAACGTCGCAGCACACGTTGCTTGTAACGTTAACATGAAGCATTACGGTCTAGAACGGTCGTCGC
TATCATGCCTTTCGAGAGGGCTCTTATTTAGTGGTAATATTCTGCCCCGCGCTTCCCTTTTCTTTTAAAAATAAGGTTAT
TGCCTAACATGCGGCTTATTAGCCCAACGATGATGATGAACAAGAGAGAATGGATATAGGACACCACATCTACCGGCTAG
TTCTTAACGGCGAACTCCACCTAGCACCTATCGGCGAACACCCTCAGCGCGTTCTTGATTTAGGCACTGGCACCGGCATT
TGGTCTATGGACTTTGCTGAGTTAGTCACTTAGGTTCTAAGACTTGAAGTCTAAAGTTTGTTTAGGCTACTGACTACGTC
GTGATCTATAGTCAGTACCCATCCGCAGAAGTTATCGGTACAGATCTAAGCCCCATTCAGCCTCGGTGGTATGTTTAAGT
GGTTACTTTTTACGCATATTCATCATTATAGTGATACTGACATTGTAGGACCCCTCCTAATTGCACCTTCGAGGTGGATG
ACTTCGAAGAGGAATGGGTATACCGTAGAAAGTTTGATTACATCCATGCCCGTGAATTAGGAGGTTGTATAGGCGATGCC
AACCAGCTATTCCGCCGGGCTTTCGAAAACCTAACTTCAGGCGGACACTTTGAAATACAGACTGTCTACGCAAAATTTCT
CTCTTATGACGGCACGGATAAACAGGCGAAAGATGCGCAGTTTTGGATGGAAAATATTTGTGCTGGCGCAAGAAAGTTTG
GGAAGCCCCTTGATTCGACACCGGAGTGGCTTGAGAAAATCAAAGCAGCGGGCTTTATTGATGTCCAGCAGGATATTCGG
ATAGTATGTGAAAAATTCCTCTTTACGGACCCGACAGTACTAATACGCCTGAAGATTCCAATAGGTGCTTGGCCTAAAGA
CGCACATCTAAAAGAGATCGGCAGATACCAGATCGTTCAGGAGAAGAAAGTCATCGATTCATACACACCGGGAATATTTT
GTAACATTCTTGGCTGGACGCAGGATGAGATTGCTGTTCTTATTGCTAAGGTGAAGAAGGACCTCGAAACCCCGGAAAAC
CATCTGTATCTCCCTGTCTATTTCATTTGGGGCAAGAAGCCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62