GenePrediction:GLEAN_1240 Details

Name: GLEAN_1240
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1566165..1573137 (+ strand)
Length: 6973
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1566165..1566462 (+ strand)
Length: 298
Type: CDS
Source: GLEAN
Position: GCSC_173:1566626..1567189 (+ strand)
Length: 564
Type: CDS
Source: GLEAN
Position: GCSC_173:1567239..1572226 (+ strand)
Length: 4988
Type: CDS
Source: GLEAN
Position: GCSC_173:1572295..1573137 (+ strand)
Length: 843
>GLEAN_1240 class=GenePrediction position=GCSC_173:1566165..1573137 (+ strand)
ATGCAAGAGACTAAGCAGAAGCTGCCGGCGTCGCCGATGCGCATCGCGGTGGTGGGAATGTCCTGCCGTCTGTCGGGCAA
TGTGTCGTCGCTGGATGACTTCTGGCAGATGCTGGCTCGCGCACGATGTGGCTGGTCGGAGGTGCCAGATGAGCGGTTCA
GCAAAAAGGCGTACCACCATCCCAACCCGGCCAAGCTGGGGGCATTCAACACGATTGGGGGGTATTTTGTTGATCAAGAC
CCAGCGATGTTTGATGCGCCCTTCTTCAATATCACGCAGGCCGAGGCCGAAGCGATGGGTACGCTCCGTGTCTGTTTTCC
GTCTGCCTTTTGTTTTGTTTTGTCACCTCCTTGGTTCGAGCTTATCTCTTTGTTTCATGTCTTCCTTGCTTGATCTTTCA
TTCCGTCCTCGATTATTCGGCCCGCTCGTCTTGTGTCTCAAACATCGGCTAACACGCACAGATCCCCAACAGAGGCTACT
GCTCGAGTGTGCATACGAGGCAGTGGAGAATGCAGGCATACCCAAGGAGCGGCTGATCGGACAAAAGGTCGGCGTGTTTG
TGGGCGGCGCCGCGTCGGACTACCGGCTTGGCACGCTTCGAGACCTGGAGCAGACGCCGATGTTTGACGCGACGGGTAGC
CACCAGTCGATCCAGTCGGGCCGAATCTCGCATTATTTTGATCTCCGCGGACCTAGCTTTACAGTCGACACGGCTTGCTC
GTCGTCGCTGTACGCGCTGCACCAAGCGGTACAGAGCATCCGCAATGGCGAATCAGAACAAGCGATCGTGGCGGCCTGCC
ATCTGAACCTGCAGCCGGGCGACTGGGTGTCCATGTCGCTGTCCAGGCTCTTCTCAGACGAGGGAAAGACGTATGCGTTT
GATCACCGGGCCAAGTCGGGCTTCGCACGCGGCGAAGGTGCCGGGGCCCTGATTCTCAAGCCTCTCGACCAGGCCATCCG
CGACAATGACCGGATCTGGTCTGTGATTGTGAACACGGGTGTCAACCAGGATGGGCGGACGGTTGGTATGTATCTCTTCC
ACCATTTTCACTGCAAGCTGTGCTGACAACAAAGGCATCACATCACCCAGTGGCGAGGCGCAAGAGGGACTGATGCGGGA
GGTGTACGCGTCTGCAGGGATCCGGCCAGAGGACGTGGGCTTTGTGGAGGCGCACGGCACCGGTACCAAGGTGGGCGACC
CGATCGAGGCGACGGCGATCCGCAACGTGTTCAGCCACGGACGGACGCGACAGCAGCCGCTGTATGTGGGATCGGTCAAG
AGCAACGTGGGCCATCTGGAGAGTGCCAGCGGGGTGATCTCGATCATCAAGGCGTCGCTGATGCTGGACAAGCGGTTTCT
GCTGCCCAACGTCAACTTTGAGAAGCTGAACGAGGCCATTCCGTTTGACGAGTGGCACGCCAAGGTGCCGACAAGACAGC
GGCCATGGCCGTCGAAGAAGCGCTACATCAGCGTCAACAATTTTGGCTTTGGCGGGTCCAACGCGCACTGCGTGCTGGAG
CCGGCGCCACGACGTAGCGGCCGGCCTGAGCTGGCGCAGAAGAACCTGGGCTCGGGTCTGGAACGGCCACGGCTGTTTGT
GCTGTCGGCCAACGACGAGGCATCGGCACGGAGGGCGGTATCACAGCTGACGGTGTATCTAGAGCAACACCCGGAGGTGT
TCCAGAAGGAGCTGCTGCGCAACCTGGCCTACACGCTGAACGAGCGACGATCGCAGCTGGGATGGCGAGTCGGCCTAGTG
GCATCGTCAGGACGACAGCTGGTCGAGGTGCTGAGCGCAGCCGAGACGAAGCCGGTGCGCCGGCCCCAGCAACCGCCGAA
GCTGGCGTTTGTGTACACAGGCCAGGGGGCACAGTGGCACGCCATGGGCCGCGAGCTGCTGGAGTCGCACGTGGTCTTTC
GCGATACAGTGCGGGCGGCTGACGCGTGCCTGCAGCGACTGGGTGCTGACTTCTCTCTGATGGAGGAGCTGCAGCGCGAC
AAAGAAACGACACGCGTAGGCCAGGCACACATCAGCCAGCCGATCTGCTCGGCCGTGCAGCTGGGCCTGACGGACCTGTT
GCGGTCGTGGGGGATCCGGCCGACGGCCGTGACAGGCCACTCAAGCGGCGAGATTGGTGCGGCTTATGCAGCAGGAGCAC
TTTCGCTCGAGGCTGCCATGACCATTGCCTATCAGCGCGGACAGGTGGTGTTGCGGCTGCGGGAGCGGTTCCCCCACTTG
CGCGGCTCCATGATGGCCGTCGGCGCAGGGCCCGACACGGTACTGCCGCTGGCACAGCGCATGAAGAGCGGCGTCGTCGT
CGTGGCCTGCGAGAACTCTCCCAGCTCAGTCACGGCTTCGGGAGACGAAGCAGCTATCGACGAGCTCGCAGCGGCGGTCG
AGGCTCTGCAGCTGTTCAACCGCAAGCTGCAGGTCGATGTGGCCTACCACTCGCCTCACATGAAGCTGGTGGCCGATGAG
TACCTTCAGATGATCGGCGACCTGGCCTCGTCCTCCTCGTCGGACGTCCGCTTCTTCTCGTCGCTGAAGGGCCACGAGGT
CGGCCTCGACAGCCTCGGGCCAGCCTATTGGGTCGACAACCTGACCTGTCCGGTGCGCTTCTCGACTGCCCTGGCTGCAC
TCTGCACCGACTGCCGGCCGGACGTGCTCGTCGAGATCGGACCGCACGCCGCTCTCGCTGGTCCGATCCAGCAGACGTTA
AAGACGCTTAGTCAGCCATCAAACGGACACAAGATTGGTTACGTGTCAGCGTTGTCACGTGGCCAAAACGCAACGACGAC
GGCGTTGCAGGTAGCTGCGACGCTGTGCATGCGCGGACAGACGGTGGACTTTGACGCGATCAACGGCGAGGAGCAGCTGC
AGGTGACGGACGGGAAGCCGACGCTGCTGTCGGATCTGACGCCGTATGGCTGGTCGCGACAGCGGTACTGGAGCGAGTCA
CGCATGTCGGAGCAGCACCGGCGAAAGCCGTTTGCGCGACACGATCTGCTGGGACTGCTGGCCGACTTTAGCAACAACGA
GCTGGCGCCGACGTGGCGCAACGTGTTGCGGACGGCGGATCTTCCGTGGCTGCGCGACCACACGATGCAGTCGCTGACGA
CCTTTCCCTTTGCCGGCTTTGTGGCGATGGCCGTAGAGGCCGCGGCTCAGCGGGCATCCATGCGGAAGACCGGTGCCGAC
GAGGGCTGCGAGTTCGTGCTGCGGGAGGTGCAGGTCACCCGGCCGCTTCTCATGGACGACGAGACGGCCTACGAGGTGAT
GCTGTCGATGGAACCGTACGCCGAGTCGATGCGGGCCTACTCGGACGAGTGGGACGAGTTCCGCATCCGATCGTGGCGAT
CGGGGCCTGGATGGACGGAGCACTGCCGTGGTCTGGTGTCGACACGCAAGGCAGCCGGAGCCGGTGGCGACAGCTCGACG
AACCCCGTCAGCACGGCACATCACGGCATGGGCTGGCGCAGCTTCCAGCGCGCTGACACAGCAGCAGACGAGAAGGTAGA
CGTCGACGCCTTTTACCGCGAGCTCGACGATGTTGGGGCAACGTATGGACCGACGTTTCGGCGGCTGCGCAATGTCCGGG
CCAGCAACGTCTGTTCAGCGGCCATCGTCGACGTGGCCGACACGGCAGCCACGATGCCAATGGAACACGAATCCGCATAT
CACGTGCACCCGGCTCTGCTAGACCAAGTGCTGCAGCTGTCGTTCCCGCTGCTGGGTGCCGGTCGGAGCGGTGGCATGCG
CACGCTGTACATGCCGGCAGCAATGCGCGAGCTTCGTATCCTGAGCGGCACGACGTCGCCGTTGTTGCCGGGATCGCGTC
TGCGGATGGCTGCTGAGACTGAGCCGGATCTCGACCTCGAACACGAAGCGCCGGCCGAGTTTGACATGACGGCTGTCGAC
CAGAACGATGCGGCCGTCATCCAGCTGGCCGGCCTGCAGATGGTGCCGGTCAAGAGCGAGGCCACGCTCGAAGACACGCC
GCGCGAGCTCTGCTACAAGCTGCAGTGGGAGCCAGTCCCGCTGGCTGGTCGACGGATCTCGGACACGTCCATTGACTCGA
CCGACAGCGGCTACGTGTCGCCGGTCCCGGCCCCGCTAGACGACGACGACAGCGGCGAGCCTGTCTGGGCCGACATGGCC
GTGTCCATCGTGTCAGACATGCCATTGACGGATCCTGTGCTTGCCTGTCTCGTCGCTGCTGTCGCAACAAAGACAAATAA
GAAGCCGGTCGTGCAGAAACTGGCTGAGGCGACATCAGACCAGAACAGTCACGTGATTTTGTGTGAGCTCGACCGGCCGC
AGCTAGCCGAGCTCGACGCCGACCGTTTTGGCCGACTGCAGGCATTGGCCACGACGGCCGCCGGGCTATTGTGGGTGACA
CGAGGCGCCCATATGCAGGCGACCAATCCGACCGGCAGCATGGCGTTGGGACTGACACGCACGTTGCGGTCAGAGATGGC
CGCCCGCGTGGCCACGATCGACCTGGATCCACGGCCGTCAGGCCAGACGGAGCGACAGGTCAGCCTAGTGTTGCAGGCGT
TTGGTCGCATCTTCCGGCCGACGACGGAGGGCGAGGACGCCGACATGGAGTACGCAGAGCAGGATGGCGGGCTGGCAGTG
CCGCGCATCGTGGACGACGTCGAGACGAACCTGCTGGTGCACCGAGAGCTGTACGGGTCAGCACCATACACGCAGGATTT
TGCACAGCCAGGACGACAGCTGAAGCTGGCCATTGGCACCAAGGGAGCGCTGGACACGCTGTACTTTGCCGAGGACGAGC
CGACCGAGCTGGGCAAGGACGAGATTGAGCTGCGGGTCGAGGCGACGGGCATGAACTTCAAGGACGTGGTGATTGCCATG
GGCCAGCTGCCGAGTCGATACTTGGGCATCGAGTGTGCCGGCGTGGTAGTGCGGACAGGCACGGCTGTGCGCCACCTGGT
GCCAGGTGACCGGGTGTGTGCGATGACCGAGGGGGCCTACGGTAGTGTGGCGCGGTGTCTGGCGACAAGTGCAGCCCGGA
TTCCCGATGAAATGGCCTTTGACGTGGCAGCTTCGATCCCGGTTGTCTACTGCACGGCGCACTATGGGCTGATCGAGCTG
GCCCGGCTGACAGCTGGCGAGCGCGTGCTGATCCACGCAGCAGCTGGCGGTGTTGGTCAGGCGGCCATCCAGCTGGCCCG
GCTGCTCGGAGCCGAGGTCTTTGCCACAGTCGGCAGCCCGGAGAAGAAGCGTTTCTTGCAGGACCGCTATGCCATCCCGG
CCGACCACATCTTCAGCAGCCGCGACACGGCCTTTGGCACGGCTGTGCGCGAGGCCACCGATGGCCATGGCGTCGACGTC
GTGCTCAACTCGCTCGCTGGCGACTTTCTGCGCGAATCCTGGGACTGTCTGGCGCACTTTGGCCGCTTCATCGAGATCGG
CAAGCGCGACATCTCCGCCAACAGCCGGCTCGAGATGCGCCGCTTCCAGTGGAACGCCTCCTTCCACTCGGTCGACCTGA
CCGTCCTCGCGACCGAGCGGCCCCGCCAGATGGCCCAGACCTTCTCGGCCGTCATGCAGCTCTTTGCCGCCAACTCCGTT
TCGGCCATCGGACCCATCTCCGTCTATGGCGTCGCCCAGATCGAGACGGCCTTCCGTCTGCTGCAGAGCGGCAAGACTAC
CGGCAAGCTCGTCGTCGTGCCCCGGACAGGTGAACAGGTCCGCGCCGTTCACCCGTCTCGTCACCATGACCGCATCCATG
GCCGTCGCTTGCTCCGTCCCGATGCCACCTACCTCCTCGTCGGCGGCACCGGTGGCCTCGGCCGCTCTCTCTCTCGCTGG
ATGGTCGCCCAGGGTGCCCGCCACATTGTCCTCCTTTCGCGTCGCGGCCTCGTCGATGGGCCCGTCGCCGATCTCGTCCG
CGACATGGCCGCCCAAGGCGCCAACATTGTCGTGCGCGCCTGCGACGTGGCTGACCGCTCCGGTCTCACCAGTGTCGTCC
AGTCTTGCGCCAAGGAGCTGCCGCCTATTGCCGGCGTCGTGCACGCGAGCATGGTCTTACGGGTAAGTTCACACTCAAAG
AGTAAAAGAGACACGCAGAAAAGGGAAAAGAACAAACACTGACCAGATAGGATGTTCTCTTTGAAAAAATGACCTGGAAC
GACTACGATGCCGTCATCCGCTCCAAGGTGGCCGGCGCCTGGAACCTGCACCACATTCTGTCAGACACACCGCTCGACTT
TTTCGTCCTGCTCTCGTCGGCTGCCGGCATCGTCGGCAACCGAGGACAGGCTGCTTATGCTGCTGCCAACACCTTCCTCG
ACGCCTTTGCACGTCACCGCTTCCAGCAGGGTCTGCCGGCCACTGCCCTCGACCTGACTGCCGTGGCCGATGTCGGCTAC
CTCGTCGACGGTGCCGATGCCGCCCGTCAGCACGAGGTTCTGCGCAATCTTGGCGGCGAAACCATCCACGAGGCCGAGAT
CCTCGCCCTCTTCCGCGCCGCCCTCACCGGCGACCTGCACCGCACCTGTGCCAGCCACTGCATGACCGGCCTCAAGCTTG
GCTCCTCCGCCGACCAGATGCCCTACTTTGCCGCCGATGCCAGGTTCACCCACCTGCGCGATGCCGTGCTCGCTACCCAG
GCTGCCTCTGGTGCTGACTCAGCAGCCACGCATGTTTCCCTCGCCGTCGCCCTCGGTCGTGCTCCCAGCCCAGAAGAGGC
CGTGGCCGTCGTCACGGCCGGCCTGGTCTCTAAGCTTGCCGGTATCCTCATGGTGCCCGCCGAGGACTTCGACCCCGACA
CCCCCATCACAAAGTACGGTCTCGACAGCCTCAACGCCATCGAGCTGCGCAACTGGATCACAAAGGAGCTGGCCACCAAC
CTGCAGGTCCTCGAGCTGTTGACCAGCGGCTCGCTCACCAACTTGGCCTCAACCATCATCAAGAAGCGTACGGCTACCCA
GACAAAGTCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62