GenePrediction:GLEAN_1241 Details

Name: GLEAN_1241
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1576602..1577205 (+ strand)
Length: 604
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1576602..1576607 (+ strand)
Length: 6
Type: CDS
Source: GLEAN
Position: GCSC_173:1576663..1577205 (+ strand)
Length: 543
>GLEAN_1241 class=GenePrediction position=GCSC_173:1576602..1577205 (+ strand)
ATGGTGGTATGTTGAAAACTGGATTTGCTCAACGAGAAATTGGCTAAATGGAGTACGATAGGACCTCAAAAATATTGATG
GCAACCAAATTGTGTCCAACAAGGGCTACTGGTATAAAATATCTCTTGCCGATGGAAGCGAGCTTGGCCTCGGCGACATC
TACCAAGGGAACTATCCTAGCGGGAAGCCGCCCCCGAATGGGAGAACTCTGGTCAAGGTCGTGCCCGCAGGACAAGGAAT
GGTCTTTGCCTACCAACGATTCGACGGCGACAACAGGTCGAATCAAGGCTGGCCAATCGGAGACAAGGGCTATCTTCGAG
GCCTTCAAGTCACTCCTGAGGGAGGCGAAATCGTCAAAAACATAAGCTTGTCTTGGGAACCGGCCAAGCTTTGTTTGTAC
GACGACAATACGAACTATGGTATTGTGGCAGAGCAACTTCCAGGCAACAGGGCTGCACTGTACGCTTACGACCAGGACGG
GACTGTTTGCGGGCTAAGGGTTGTACCAGGGGGTAACGTCATCGCCCACAAAAGCACTCATGCACTCGCTCTTGATTGTC
AGATAGTGAAGGTTGGAACAAATAGGTCTACTGGTGCATGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62