GenePrediction:GLEAN_1243 Details

Name: GLEAN_1243
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1589167..1590542 (+ strand)
Length: 1376
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1589167..1589236 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_173:1589307..1589437 (+ strand)
Length: 131
Type: CDS
Source: GLEAN
Position: GCSC_173:1589491..1589981 (+ strand)
Length: 491
Type: CDS
Source: GLEAN
Position: GCSC_173:1590044..1590542 (+ strand)
Length: 499
>GLEAN_1243 class=GenePrediction position=GCSC_173:1589167..1590542 (+ strand)
ATGGACTTGCTTCGGGTCCTCGCCTCCGTTCTGATAGCGCGAGAGACCGACGAGGCCTCTGTGAATAATGGTATGCGCAA
AGAGAGAGACAAAAGGCCGAGAACGAACGAGCAAGCCCACAACGTTAACACACAATGAAGGCCCCGCTGGTCTCGGCATT
ATCTGGACCATGGTCGTTCTGGCCTGGCTCATTGTGCTCCTGCGGCTCTATACGCAAGCACGGATCACTGGCCAGTACGG
CCTCAGCGATTACCTGATGCTTGTCTCCGTGGTATGTACGAGAGCCCAAGGCCGCGCGCGAGAAACGCCTGCCAACCAAG
TCAGATCATCATCACCGCCTTTGCGTCCCTCATATCCGTGCAATACCACTACGGCTGGGGCCGCCACCAGGCCTATGTGG
ACGATGCCGATCTTGTCCAGTTCTTCAAGTTCAACATCACCAGCCAGTCCTTTGGAATCCTGGGCTCGACCCTGGGCCGC
CTCTCCTTTATCGTCTTCATGGTTCAGCTCTTCGGCTTCAAGAAGAGCCTTGCTCGTGGCCTCTGGGTCCTCTTTGCGCT
GCAGTGCATCACCAACGGTGTTGCCATCATCTGCATCTATGCGCAGTGCTCCGATGCCCGCGCCCTCTACAACCACTCTG
TCGTGGCCGACTGCTGGCCAGATTACGTCCAGACCTACATTGGCTATGGCCACACTAGCTTTAATGCCCTGACTGACCTG
ATCCTGACTGTGCTGCCGCTAAAAATGATCTGGAACTTGCAGATGAAGCTGCGCATAAAGATCTCCGTCGCCGTACTCCT
TAGCATGAGTATCCTGTAAGAGATCTGGCCCTGCCATCACGCCCCCCCCCACCCCCCATTTTCTGACTGCGTTCTAGTGC
TTTTGTCGGCGTTATCATGAAGATTGTCTATCTGAGAGCCCTGTCTCATCGTGGTGATGCCACCTACAACACCGTCCCCA
TGTTTGCCTGGATTGTCGTCGAGGGCACGCTCGTCGACATTGCCGGCTCCGTTCCGCTTCTGCGTCCGCTCTTCAAACCC
TACCTCGGCGACAGCTCCACGGCACGGCCACACTACGAACTATCACCCTTTTCTGCTCCCCTCAGCCAGTCTACCGCCAC
TGCTGGCGGCTTCAGCTTCAACAAGCTGCGCGAGGCTACCCACAGTAATGTCCTTAAGAGCGCCGTCGTGCATGGCAGCG
GCAGTCAGGAGGACATTCTCAGTGCCAGCGGCGTTGGCCCTAGCCACAACGGAAAGATCACCGTCAGGGAGGAGTTCATA
GTCGATTACGGCACCGACAACAAGATTGCTAGCCCGCCGACCCCTAGCCGGAGCTCCACGCAAAGAGGCCCAAGCCGCAC
CTCGTGGTCTGCTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62