GenePrediction:GLEAN_1244 Details

Name: GLEAN_1244
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1599525..1600418 (+ strand)
Length: 894
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1599525..1599580 (+ strand)
Length: 56
Type: CDS
Source: GLEAN
Position: GCSC_173:1599777..1600176 (+ strand)
Length: 400
Type: CDS
Source: GLEAN
Position: GCSC_173:1600389..1600418 (+ strand)
Length: 30
>GLEAN_1244 class=GenePrediction position=GCSC_173:1599525..1600418 (+ strand)
ATGGAAGTTCACGTTAAGGACACACCTGTGCTCGAGACATTTTCTAAAAGACGACAGTAAGCTCACACAAAAGATAGCCT
CAATTCTCCTCAAACTTGTTAGTTCCGACCACAAACCTAGCCACACCAGGATCGCTTCCAGAGTGGACTAAAGGGACGAT
TCACCAACAGGTGACTTACTGCAGTAGGTCTAGAGGCTCTCCCATTTAACTTATATATCCACCGCGTGCTAACGCTGTCC
AGACGACAGCAGCTCCAAAACAAACCACAAGGGTTCCGCCGAGGTCTGCTGGGAGGATCAACGAAACCTGGCCTTGAGAA
AAGCCCGGACTATGACGCAATCTGCCGATATAGACGGTATTGTTCTGCACTCTATCAACAAGCCAACGGCCGATACGTCC
CTCTCGCCCGACCTCAAAGGCATCAAGGTAGGCCTCAACGCAATCACGGCCAACGGCGGTACGGCCATCGGCACTCAGCT
GTGCTGCCAGATCCGCAAATTATTCGTGTGTCAATTGTTGGTGTCGGTGGTGGCAGACAGCGGACCCGGCGACGGGAATG
GCAGTGTGCTGGCACCGAATATTGTCGACTGCGGCAACGATCTTTCTAGCAAGCGTTATCTACAGGTTGTGCTTGGAGGA
AAAGCAGGACTGGTAGGAGGGACTGATATGTGGTAGTCCTGTAAGGCAATATTCTCGGCCTAGAGAAGTATACAACCGTA
AGAGCATTGTCTTAATTCGAACAAAATCCATTATATTATTTTACCCAATCCTTACTATCCGGACATTTGTCCTAGCCCTA
TAATTTTATTACTAAAATCTTATACAAAGAGACTAAGTGCAGCACCGTAACCATTCATTTATAGATTATGCCCAACGTAG
TCCTTGCAGCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62