GenePrediction:GLEAN_1246 Details

Name: GLEAN_1246
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1604089..1605538 (+ strand)
Length: 1450
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1604089..1604214 (+ strand)
Length: 126
Type: CDS
Source: GLEAN
Position: GCSC_173:1604709..1604749 (+ strand)
Length: 41
Type: CDS
Source: GLEAN
Position: GCSC_173:1604805..1604894 (+ strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_173:1604959..1605538 (+ strand)
Length: 580
>GLEAN_1246 class=GenePrediction position=GCSC_173:1604089..1605538 (+ strand)
ATGCCTACTTCAGCTAAGATGTCTTCGCCTTTACCACCCACAGCACCACTCGTAGACGCAAGCGGCCCGGTATCACCTCC
AGAAACTGCACCCTTACAGGCCTGGGCTAACCAGGAACTTCATGAGGTAGGCGTTCTACACGACTCGCCCATTAATTGCT
GCAATTCACTTAGTCCATCTGAATCTGTGCATAGGAAGCCGATGGTGACTCCGCGTTTGGTGACGACTTGTCGAACTTGA
CGGCGTCGCTCTCGAGCAGCGTTTTCCGGTACCGTACAGTGAACGGCAGGACATACCACAGCGAGCGCGGAACAGGAAAA
TATTAGTATGAACAGAAACTCTCTCCCCCTTTGCCCCTCTTCTCTTTTCTTTGCTTATGCAAGTAGTGCTTCAAACGATG
AGAAGCAAAATGAGCTTCTTGACATACTGTTAGTTTCTTATGTTTCTGATGCAGGCATTGGTTTTGTTGGCTTTGGACTG
AAATGAAACAAGGCATCATGCTTTTACCCTTGCCATTGATGGTAAGAGCCACCTAGCACCTTTGCTAGATGATATAGGAG
TACATATATAAACCCTCTTCTTTATCTTTTATATGTGATCTACACTGACACTCGGCTTAGAAAGTCATCGATGTCGGTAC
GGGAACGGGCATTTGGGCCATGTAAGAGTTGTCTTCTACTGATAGGACATATGGCCATAGACTTACATGCATGCAGTGAC
TTTGCCGACGAGTACCCGGAGGCTGTAGTAATTGGCTTTGATCTATCGCCTATCCAGCCGATATGGGTTCCGCCTAATGT
TAAGTTGTCTGTACCCTCTGTCGTCTTTCGTCTTTCGTCGTTTATACATAAGGTGTAGCTAACTTGAAAGTCTCGTTGAC
GACTTTAACGCTGAGTGGCTATATGGTGATGATAACGACTACGTGCACCTACGCACCCTAGTTGGCTGCGTTACTGATTG
GACAAGCCTTTTCAGCAAGGCTTACGCCAGTCTAAAACCTGGCGGCTGGGTTGAGTCCTGCGACAACAATGGTGGCTACC
AGTCCGATGACGGTAGTCTAACTAAAAATATGGCCCTCTACCAGTACAAGCATATTTTTATAGAGGCTTTTGAGAAGATG
GGCTTCGAGGCTCGTACTATGATTGTTGATGAAAATATTCAGAGAAAAGCGATCGAGGAGGCTGGATTCATCAACATCCA
CGAAAAAATAATCAAGGTCCCCACGTCGGAATGGTCCGATGATCCGAAGCTAAAGGAGATTGGAACCTTCACGCGTGTCG
CTCACCAGGACGTCGAAGGTCTTGTTGGCCTCTGTGCTACGGAACTCGGTTGGTCGAAAGAAGAGATTATGGTTTACGCA
GCCAATATGCGAAAGGAGCTTCGCAATCCTAGTATCCATAGCTACATTTTGGCCAAAGTTGTCTGGGCGCAGAAGCCACA
TAGCAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62