GenePrediction:GLEAN_1248 Details

Name: GLEAN_1248
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1617814..1620227 (+ strand)
Length: 2414
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1617814..1618264 (+ strand)
Length: 451
Type: CDS
Source: GLEAN
Position: GCSC_173:1618339..1620227 (+ strand)
Length: 1889
>GLEAN_1248 class=GenePrediction position=GCSC_173:1617814..1620227 (+ strand)
ATGAAGTGGCTGTTTAATTCGTGTGGACTATGCGGTGACAACGTGGAGGATGCGCCGGATAACGAACGTCAGCCGCTTCT
GTCTCCTGGAAACGGACCCGGTGATACCGATGATACCGCTCTTCAGCAGCGTGTCCGGCAGAAGCTGCAAACGTTTCAAA
TGCTGCAAGCGACGACACAGGGTTATTTTCCCTCCACAAAGCAGCTGACAGACTACATCAACACACTACTTAAAGATCCA
GAAATGGACGTTGCTCGTCGACTCAGCCCCTCGGGGAAGAAGCTTTTGCGGCTCAGTCGAGAATGGTCAACGCAGCTGGT
GGACCTGTTGCGGAACAAGAACGGCGGTGATCAGATTCAAGACTTTGCGTGGTACGTCTCGCGCTCCTCTGTATCGGTGG
ATCTAAAGGACGTACGGCACAAGAATTTGGGAACTGCAAACGGTACAGCAAGTAAGCAATTCCTAAGCTTCCGAGGTAAA
CCTTTCTCTTCAAATGGTATGTTAATCTATCCCACCAATTCTCAGTGCAGCAGAGTCTTCAGACGTTTGGGTCACTATTG
TTGTCCAATTCTAGCGTACGACTCCTCTTGTCCGACGTTATCGCAGTTGGACGGGAAGTGTTCCGCGACACAGCATTTGC
GCTTTCAAACGCATCGCAGACTGCGGCATCGAACCTCGAGTCTGCAGTGCTGAAAGAAACTGAGATTGAATCCGAGACAG
CGGGAGGGAGCAAAGGACAGGGTGACGAGCACGACGCTCAGGACAGCCTACAAGATGCCAAAGACAACGTAGCCGACATT
GCGAATGAAGTGACGGGCGGCGCGATGAAGGTGGCAGAAGCAGCACAAAATAGCGTATCGAGCAAGCTGGTGGACAACGA
AGACAACACGCGCGATGTCCTGCTTTCACGCTTGCGGCAGGCGGTGCAGCAGCTTCAACAGCAGCCCGACTACAGCAAGT
CCGTATCGATGCTGACGCAGCTCTTGGAGCGATGCTTGACCATCTACACACGCACTCTGGTGGACACAGTTGAGGACGTG
GCGGAAGCAGTTGAGACCAACGACGAAACAGATGCAGCGCTGCACAACTTCTGGACGTTTGTCTCTTCTTTTGGCGATAC
GGAGGCTTGGGAAGAGCTGAGCACCCGCTTCCAGCGTCTGTTTGACCGCGCAAGAGGCAAAAACGACAAGCAGCTCAAGG
ATTTCATTCATAAGTTGGGTACGGCCTTGCAGGAGATGCTGACCGATCCCGACTACTTTGCCCGTGCTGGCAGCCGCCTG
GACGAGCTTCGAAACATGGTGCAGGAGCTGGATGGGGCGGTCTCATCGGCGTCCTCGTGCACACCTGAATCCTCGTCTGT
GCAAAATGAGTTCGATGCTCTGCTCTCTCAGATGCAGGTCACCATCCAGTCGGCTTTCCAGGACCACGATGTTGCCACCT
TCATGGACACCTCTGACAGCATCGCGGATCTTCTGTGGCCCGGTGGACAGTACGGCAGCGCCGAGATCCTCGAAGATGCC
GCTAGCATTTTCCTACCGCAGATCATTCAGGCTGTGCAGTACGTCCCAATACCGCGACTAGAGGTGGCCACACCGGATGT
CGACCTGCTGCTGGAGAACCTGGTTCTGCAGCCGGGCCAGACTGTGCGCCACTCGTCCTTTCTGCCCTTCCGTCTTCATT
TGCAAATCCGCAACGACTTTGACGTGCGCAAGGCCCGCTTCGGCACGGCCGCGGGCATCGCAACGACGGCATCCATGGCC
ATCGACGGCCTGTCGGTGGCGGCAGACGACGTGGGCTTCGTGCTTCGCCTGCATGCGGGACCGCTGCTGCGATACACCGA
CGAGGGTCTCGTCTCCTTCCACCTCGACGAGCGCGGCGTCGACGTGCATCTAGACGTGGAAGTCGTGCGCGATTCTGCCG
ACACCGTTCTGGCACTCCGGCAGACGCAGGTACACATTCACCACGTCGGCTTTCGCGTGCGCCGCAGCCGGGCCTCATGG
CTTGCCTGGCTCTTGACGCCCGTCGTCCGGCCTCTGCTGCGGCGGACGCTTGAACGGCAGCTGGCTGAAGCCATCGCCGA
GAATTTGCGCGTGCTGAACCGCGAGCTGGTCTTTGCGCGGGAGCGATTGCGAGCAGCCCGCATTGCTAGCCCAAACGACA
TTGGCGCGTTCCTGCGTGCCATCGCCGCTCGGTTTGCCGACGGCGAGGGTCAGAACGGCAACCCCGACCAGAGCGTCCGC
GTGGGCCTGCAGCCGATGGCGGATGGCCCCTTTGCAGGCGTGTACGCCCCAGGAAGCCTAGCGCGCGTGTGGGAGGAGGA
GGCGGCGCATGCTGGCGAGCGAGTGCACGAGTACAAGCGGGACGGCTGGCGCAATGCGGTGTTCGATGTGCCCAATGTAG
CCGATGGCCAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62