GenePrediction:GLEAN_1249 Details

Name: GLEAN_1249
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1624478..1626090 (+ strand)
Length: 1613
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1624478..1624661 (+ strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_173:1624732..1624793 (+ strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_173:1624857..1625105 (+ strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_173:1625160..1625398 (+ strand)
Length: 239
Type: CDS
Source: GLEAN
Position: GCSC_173:1625456..1625552 (+ strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_173:1625607..1625731 (+ strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_173:1625802..1626090 (+ strand)
Length: 289
>GLEAN_1249 class=GenePrediction position=GCSC_173:1624478..1626090 (+ strand)
ATGACTGAAGTCCTGCCTTATGAGCTGTACTCGGACGCGCCGGGTACGCTGTTTGTCAAGCACGAATGGGAGGAAGCCAA
TGCTGCGCACCCGGCCGGCCATGACTTTGGCGACGTACCAGCTGGCTGGCCCAAACGCCTTGAGGGTCCGCTGGCCTGGG
ATGGAAAAGACCTGCAGGTGCACCGTAAGTTCGCAAGAGAGACGCGCCTGAACTCGGCAGTTGATAGTTCCGCAAGCTGA
TGCTGTTTTCACAGCGGAGAAGTTTGTGACTGTTCTCACGGCGGGCCAGATAGCCGAGATCGATGCCGCATCCAAGGTGA
GATCAACACTTGCGCGTTGCATGGGGGGATGTTCCCAACCGCCTGCTAACCGTCGCCAGTCCTTTGCAAAGCTCTCTCTT
CCACTCTCGGCCGTCAATCGTTCCAACTTCCCTCTTCCTACCGTCAGCAAGTTGCTCCGGGGCGTCGCTCACAACATATA
CAAGGGCACCGGGCTCAATCTGCTGCGCGGTTTCCCCATCCAGAACTATGACAAGGAGGAGCAAATCCGCATCTTTCTCG
GCATAAACTCTTGGGTGGGAGATGAACGGCTGAGCCAGGGTATCGGCCGTGGTGTCTGCCACATCAAGGTATGTCCAGCC
TCATTTTGCTGTCTGTCTCCGGTCTCTGACACATTCGCTTAGAGCATCACCCACCTGGATCCATCCATCCGCGGTAAGGT
CTTTGTCTCGGCCCAGGACACAAATGCGCAGATGTACCACAGCGACGCCGGCTCGGACGTGGTGTCGCTGATGGCCTTGT
CCCTGCCGGAATCGGGTGGCGAGTCGACCGTGGCCAGCAGCTGGCAGGTGTACAACCACCTGGCCCAGCACAGACCAGAC
ATCCTGCGCGTCCTGGCCGAGCGCAAGTTTCGCTGGAAGGCGTAAGATACTCTCGCGTTTCCTTCTTGTTTTCTCTGAAC
ATCTGCTGATGCGAACAGCGTGGGCATTCCTGACACGGGCGTGAACCTGCTGCACTGGCTCAACGAGCAGCTGTATCTGA
ACTTTTCGACAAGAACGTTTATCGGCTATGGCGAGGTTCGTTCCCGATTCTTCGTCCCTAAGTATACTGAGTATGTACTG
ATTTTGCAGCTTCCGGAGCGCGACCTGTCCTATCCGGCACTCACCTTGGAAGAGCGCGAGGCCTTTGGAGGGTGGCAATG
GATTGCCGAGCAGTACTCGCTCGAAACAGCGCTGCAGATTGGCGATATCGAATGGTAAGCATGTTTCCCTCTTCCCAATT
GTGTAATTTGTGTAATTTTGGGGAGGGTCGGTCTAACAAAGAAGGGTCAACAATCTGCATCACCAGCACGCCCGTCGCGG
ATTCACAGAGGACGTCTCGAAGCCAAGACATTTGCTACGCGTCTGGCTTCGTGATAACGAGCTCTCGCCGGTGTTGCCGA
CCGACATCAAGAACAAGTTCGACCCCATGTTCAACATCGCGCCTGACTTCTATCCATTGGACGAGATCGAGGAAGACGAG
CGCCGCAAGCAGACAGGCGTATTCACAGCATCCTGCGATGAGGACACCGCTGCCGAGCGACTGGAGAAGGGCATCATGAT
TGCAAACCGATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62