GenePrediction:GLEAN_124 Details

Name: GLEAN_124
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:841530..842108 (+ strand)
Length: 579
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:841530..841870 (+ strand)
Length: 341
Type: CDS
Source: GLEAN
Position: GCSC_179:841937..842108 (+ strand)
Length: 172
>GLEAN_124 class=GenePrediction position=GCSC_179:841530..842108 (+ strand)
ATGGACGAAGAACGGACACGGAAGTCGGAAGAGCAGCCCCAACCACGGATACAAGGTCAAGAGGCAGAGACGCCATCACA
CCACGAACGAACCGCAGACCTGGCCGACTCGTCTCACTCTGACGACCGGCAAGACGCCATTATGCAGTCGCCTATACCGA
CCAGGCCTAAGCTTCCGAGCCGGAAAAGTAGCGGGACAATTATTATTTCGAGAGACTCGGAAGAAGCTCTCCATCCCGTT
GATTCAAGGACGGATTACGAAGATGTGACAGCTATGAGTCCACGGCGAACTAGCCAGGATCTAGAAGAGATGGGTCGCCA
GACACGAGATGAAGTCCGAAAGTGAGTAGTTATGATGTCATAGCCTGGGGCTCGCCAGGAGCAAACAGTTGAACTGACTG
TTGCCAGACATGCCAAGATGCTGCAGGACTCCCTCCTCCTAATCTTCCACAGAATCCAGGCCGTCAAAGAAGAACATGAC
AAACTGGACAGCAACAACAAGTTTCTGCAGAAGTACATTGGTGATCTCATGAGCACGAGCAAGATCACAGCTTCCGGTAG
CAGCCGGGCGAAGAAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62