GenePrediction:GLEAN_1251 Details

Name: GLEAN_1251
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1638192..1639217 (+ strand)
Length: 1026
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1638192..1638930 (+ strand)
Length: 739
Type: CDS
Source: GLEAN
Position: GCSC_173:1639084..1639217 (+ strand)
Length: 134
>GLEAN_1251 class=GenePrediction position=GCSC_173:1638192..1639217 (+ strand)
ATGCCTCTCACAGACGCACTGGCCGGCAAGCCATACGCTCAGCTATCGGCCCATGTTCCCAACGCGACAACGACACCTGA
CGGCGCCTTTAGCTGTTTCGGCTGCGGTCGCGATGGCGGCGAGAAGGCGTCGCCGCCAGGTCACAGACGCGCACGCCTGC
TCGCCAAATTGAAGAGCCCGCTGCGCCTCTTTCGCCACGCCGAGCCGGCGGCCGAGCCGTCTGGCATAAGTCGTCTGGCC
ACAGTGCGGGCCAAGGCGGTCCGGCTCGCCGCTGCTCTCTGTTTAGGCAAGGCCGCCGCGGCGACGACGTCGCCCGACGA
GACCACAGCCCTCGCGGAGGAGCATGTGCGAGAGCAGGGCCGAGGCGCGACCGGGGACGAGGACGAAGATGAGGTCGGAG
CCGAGAGCGAGAATGACCATGGTCGCCTGTACGGAGACGGGAACGAGGACGAAGACCTCGAAGAAAAGTCATTTGCGTAT
CTGCCGGCGACTTTTCAAAGCTTCAACTTCCTCGACGACCCGCAGGAAGAAAAACTGCCGTTCATCGCTGGCCACCATCG
CGTTGTCGACTCGGCCCAGTCGATCCACTACTGGACCAACCGCTACCTGGCACTCTACGACTGCTATGTGTATGCGCCGC
CACCCGACAGCGACTACGAGGAGAATAGCGATGCCGAGTCTGAGGCCGAGTCCGAAGTCGAGTGCAACGACGGCGCCTCA
GACTACCACTACTACGCCAGTCGGGACGCCATGAGCGATGACAGCGACGACAGCCTCTACGACGGCTGCCAGTACTACGA
CGAGGACCGTGATGGCGCCAGTGATGTGGATGACCGCAACAGCGACAGCGACAGTGACGGGACCTCGACCAAATCGCTCG
AGCGGCGTCAAGCCACCAGCCTCCGCCTCTTTCGCATGCTCGAGACGTTTTGCATCACCGTCGAGGCCCGCGAAAGCCTG
TACGAGTTCGAGTGCCATTTTGCTCAGCACCACAGTTTCCTCACGCCACCGTTCAGCGGCACTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62