GenePrediction:GLEAN_1252 Details

Name: GLEAN_1252
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1649762..1651863 (+ strand)
Length: 2102
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1649762..1651493 (+ strand)
Length: 1732
Type: CDS
Source: GLEAN
Position: GCSC_173:1651637..1651863 (+ strand)
Length: 227
>GLEAN_1252 class=GenePrediction position=GCSC_173:1649762..1651863 (+ strand)
ATGCCTCCCAGGAAAGCTTCAGCTGCCAGTAAGGCAGCTTCCGACGCGAAAGCGGCGGCATCTGTCAAGGCGGCGGCGGC
GAAAAAGACCGGCGCGACAGCAGCAGTCAAGAAGACGGCAGCAACGGCAGCCAAGGCCGACAAGGCCGACAAGACAGAGA
AGAGCACGACTGCAGTGGCCAAGCGCAAGCGCGGCGATGCTGAGGCGGCGCCAAAGGAAAACGGTGTGAGCACAAGCGTC
AAGGCTGCGCCCAAGAAGGCCGCTCCTGCTGCGGCTGCAAAGAAGACTGCCGCAGCAGCCAAGAAGGCCAAGGCGGACGT
TGTGGACAACAAAGAGAACGCGACGTCTCTCGCCAACGGCGACAACAAGAAGAAGCGCGCCCCTGCGGTGTCCAAGGCGG
CTGCAGTGCCTGCCAAGGCCAAGACGACCAAACGCAAGGCTTCAGATGTGGAGGAGGAGAAGGAGGAAGAAGAGGAAGAG
CGGGCAGAAGCTCGGCCGACCAAGGCAGCCCGCAAGACAAAGGATGCCACGACAGGCAAGGCGGCAGCGGCAGAGGCCAA
GGCAGCAGTAGCAGAGGCAAAAGCAAAGGCGGCAGAGGCAAAGGCAGCGGCAGCAGCTGAAAAGGCGGCAGCAAAGGCAG
CAGCAAAGGCAGAGGCAGCTGCTGCCACGGCAGCGACTGCTGTTGCAGTGGTCAAGAAGCCAGCTGGCAAGGTCGGAGTC
AAGATCAACGAGGCGCCGACGAAGCCGCTGGACGTGTTTGTGTTTGGCGAGGGTGGTGCTGGCGAGCTTGGGCTGGGAAG
CGTCCGGTTCGAGGGCAAGAAGCCGATAGACGTCAAGCGGCCACGGCTGAACCACAACCTGGCGGCCGGCCGAGTGGATG
TGGTGCAGATCGCGGCGGGTGGGATGCACGCGGTGGCACTGACCAAGGACAATCGGATCCTCACGTGGGGCGTCAACGAC
CAGGGCGCACTGGGCCGCAAGACGAACTGGGAGGGTGGTCTACGCGATGCGGACGCGGAGGAGGAAAGCGACAATGAGGA
TGACACGGGGCTGAACCCGCTCGAGAGCACGCCGACGGAGATCGATACAGACGGCTTGATCAACGGGACCAAGTTTGTGC
AGGTGGTGGCTAGCGACAGCGCGACGTTTGCCCTGACGGAGGACGGACGGATCTACGGCTGGGGCACATTCCGGGCCAGC
GACGGTGTTCTGGGCTTTTCCAAGGACGTGTCAATCCAGCGGACGCCGACGCTGCTGCCGGAGCCGAGGAAGGTCAAGGC
ACTGGCGACGGGCTCGAACCACATTCTGGCGCTGGACACCAAGGGCAAGCTGTACACGTGGGGCTGTCCGGAGCAGAACC
AGCTGGGCCGGCGCTGTGTGCAGCGGGACATCAAAGAGTCGGCGCTGCGGCCGGGCGGTGTGGGTTTCCGGCGCGGCGTG
CAGATCGAGAAGATTGCGTGCGGCTCGTATCACAGCTTTGCCGTCGACGATGGCGGCCGGGTGTATGCCTGGGGCCTGAA
CAACTTTGGCCAGCTCAACGTCGAGCAGGGCGCGGGTGACACGGACGCGACCGTGCTAGACGCTACGCTGGTCGAGGGAC
TGGCTGCCTTTAAGATTGTCGACGTGGACGGTGGCGAACACCACTCGCTGGCCTGCACGGCCGACGGCAAGTTGCTGACC
TGGGGCCGTATCGATGGTCATCAGGTTGGTTTCGATGCCGGGGCGTTCAACAGTGAGAATGCCATTTTTGATGAGCACGG
CAAGCCTCGGATTTTGAAGGAGCCGACTATCGTTCCTGGTGAGTGAGATAGAGGGAAGAGAGAGAGAGAGAGGGAGAAAG
AAAAGAGAGAGAAAGAGACAGCGCTAACTACTTAGAAATCCCTCCTGTGGTTCACGTCAACGCTGGCACGGACAACAGCT
TCGCGCTGACGGAGGATGGAAAGGTCTACTCCTGGGGCTTTTCGGGCACATACCAGACTGGTCAGGGCACGACGGAGGAT
ATTGAGACGCCGACGCTGATCGACAACACGGCCGTGCGGGAGAAGAAGATTGTGCATGCCAGTGCCGGCGGCCAGTTCTC
TCTGCTCGCAAGCGAGGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62