GenePrediction:GLEAN_1253 Details

Name: GLEAN_1253
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1654067..1654587 (+ strand)
Length: 521
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1654067..1654069 (+ strand)
Length: 3
Type: CDS
Source: GLEAN
Position: GCSC_173:1654141..1654587 (+ strand)
Length: 447
>GLEAN_1253 class=GenePrediction position=GCSC_173:1654067..1654587 (+ strand)
ATGGTTTGTCGCATCGCACCGGATGACCAGTGAGACCAGAAGACCAGAGACATGGAGCTGACCGTCTCGCGCAGGCCTAC
CGCCTGATCACGCAGGTGGTCCTCATCGGCTCGCGCGTGCTAGGCCGCGCCTTCACCGAAGCCTACCGACAGGCCAATGC
ATCGAGCCAGTATGCCCGCGCGCAAGCCAAAGCCGGCGGTGCTGTCGGCGGCGGAGCCACCGGTCGGGCGAACCTGTCGA
CGGGCATGACGCTGGACGAGGCTGTGCAGATCCTCAACGTGCCGCGGCCACCGCCGGCGAGCGCGGGTGCGCGCGACTAC
AACATGGAAGAGGTCATGGGCCGGTTTCGGCGGCTCTTTGACGCCAACGATCCGCAAAAGGGCGGCAGCTTCTACCTGCA
GAGCAAGGTGCTGCGGGCACGCGAGCGGATCGAGGCCGAGGTCGGACCACTGCTTGAACAGGCCGCCCAGGAGGCCGAGG
TCAAGGCCGGCTTCAAGCCCAAGATGTACAAGGACCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62