GenePrediction:GLEAN_1255 Details

Name: GLEAN_1255
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1664089..1665731 (+ strand)
Length: 1643
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1664089..1664156 (+ strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_173:1664247..1664278 (+ strand)
Length: 32
Type: CDS
Source: GLEAN
Position: GCSC_173:1664327..1664391 (+ strand)
Length: 65
Type: CDS
Source: GLEAN
Position: GCSC_173:1665156..1665731 (+ strand)
Length: 576
>GLEAN_1255 class=GenePrediction position=GCSC_173:1664089..1665731 (+ strand)
ATGTCGAAAAACGAGAGCGATGCCGCCGAGCAGGCGAGGGAAGACGATGATGACGAGCCGGATGAATGGTGGGCAGCCAA
AAGAAAACCAAAACACATGAACAAAGAGACGATCCGGAGCACATGTTGCTGACTAACGTCGTGATTTCGTTTTTACAGGG
ACAAGCGCATCTTCAGTACAGGCTGTGCAGGTGTGTGGCAGACATAGCGGCCATGTATTGCAATACTGACAGTTGCAGAC
GAGAACGCAAAGATGACCGACTGTTATTTTGACAAGAAGGATTGGCGAGCCTGCAAAGATGAGGTAGGGCCGCAGCACGA
GATCTGGAGAAGCAGCGTCTGCTAACGAAGCTTTGTTGCAGATGGAGCGGTTTCGACAGTGCTGGAAGCAGCACAAAAAC
GACGAGAGGACGTTTACACAAGATGTCGCGCCGGAAAAGTGAAGTTGGAGAGACAAGAGTGTAGGAATAGATTTAGGAGT
TTCAGGCAATTGGATTTTACTCAATTGACGTTCTTGCACGTCGTTCCTTCTGTACGGAGTACAAGGCAAGAGCAGTCTGC
ACTCAGCGGCAGAAACCTGCTTGGCACAGCTTATCCAAAGTGGGGCTCGTCACGGGTTTCCTCCTCTACTCCGCAAGCAC
GAATGAAAACAGCGTTGGGCATTCCCTCTTTCCGACCTCCCACCAGACAAACGGCGACGAACAGACACGCACGCCCGCCC
TCACAGTCGACCTTGTTCCTCGCACACGACGATCCCTTCACTCTGCCATGGCCGCCACGCAAGTGACCCGGGTGCTGTCG
CCGGTGCGGGCTTCGTCTCGCCGGCTCCCGCTGGCCGGCCTCTCTCTGATGGCGAGTCGCCAGCCGTCGACGACGACATG
GGCAGCGAAGCCGCCGACTGGCCGCCTCTTTCACGCACATGCACGAGCTGCCTTTCCGGCGCCGACACGACCGACGGCAG
CGGCAGCCAACGGTAGGACGCCTGAGGCTGAGGCCGAAGCGGTAGCTGCTTCTGCTGCTGCTGCTGCTGCAGAACCACTT
TTGCCGCCTCTGCCCGGCGTGCCTGAGACCGGTGCACCGACGGGCCCGGCTATTGACTGGTCGGCGTCGTTCCATGGGCT
CTCGATGGTGCCGTTTGCGCCCGAGGTGGCGGCCAAGCTGATGACGCCGCTCGATCCCGAAGACGTCGAGGTCAAGCCGG
ACGGGATCCTGTATCTGCCCGAGATCAAGTACCGGCGCATCCTCAACGGGGCGTTTGGGCCGGGTGGCTGGGGCCTGGCG
CCCCGCGGCGAGCTCACGGTGGGCGAGAAGGTGGTCTCGCGTGAGTACGCGCTCGTGGTGCAGGGCCGGTTCGTCGGCCA
GGCTCGGGGCGAGTGCCCGTACTTTGGCGACGACGGCGTCGCCACCGCCGGTGAGGGCTGCAAGTCCAACGCGCTCATGC
GCTGCTGCAAGGACATCGGCATCGCCTCCGAGCTCTGGGACCCCCGCTTCATTCGCCAGTTCAAGCAGAAACACTGCCGC
GAGGTCTGGGTCGAGCACGTCGCCACCAAGAAGCGCCGCCAGATCTGGCTGCGCAAGGATTGCCCCCCGACCTATCCATA
CGCCCTGCCGTCCTCGTCCCCGGCGCGGACACCCACACGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62