GenePrediction:GLEAN_125 Details

Name: GLEAN_125
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:845479..846830 (+ strand)
Length: 1352
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:845479..845973 (+ strand)
Length: 495
Type: CDS
Source: GLEAN
Position: GCSC_179:846088..846384 (+ strand)
Length: 297
Type: CDS
Source: GLEAN
Position: GCSC_179:846446..846544 (+ strand)
Length: 99
Type: CDS
Source: GLEAN
Position: GCSC_179:846600..846830 (+ strand)
Length: 231
>GLEAN_125 class=GenePrediction position=GCSC_179:845479..846830 (+ strand)
ATGGCGGTCAGAGTGTCTTCGTCGTTTCTGCTGCTGCTGTTCGGCCTCGTGGCTGCCGTAGTCGTCCAGCTTGCACGACA
GAGACAGAAACGAGCAAGCCGATACCGGCCGGCCAAAGGTGTTCTGGCTCCGACTGCAGCACATGGCGATGTGAAGCAAG
CGGTCTCATCGCCGCCGACATGGCCACCGCCGATCAGCCCGGCCGACTTGGACTGGGAGGGTTCCGATCCTCGGCCGTTT
CGGCCGTTCAAGCCGGTCTACCACATTACCATGGCCCTGCAGTCGTCCGTGCCGGAGGACCTGATCGTGCTGGACCGCAA
CTACCGGGATCGCATCGATATCCGCCGTGCCGTCATCGTCGCTCATCCGAAGACGGTCATGGGCATCATCCCGTCGCCAG
ACTCGCCGTCGGACCCGAGCCCCAAGGCCAAGGCGGCCGTCGACGAGCTGTACGAGTATTTGATGGGCTCGTACCTGCCG
GCACGCTATCCATCTGTGTTTGTCTTGCAAAAGCAGCAGCAGCAGCAGCAGCAGCAGCAGTCTGCCCATCTGCACAACCG
CATCACTGGCGCCACGTTTCCCTGCACCGCGCCTGCCGACCCGCTCGAGGCTTTCCGCATCCTGGCCGAGACGGTCGAAG
ACGACTTTTTCCTGCTGCAGGAAGAGAATGGCATCACGCCTGTGCCGGCCGAAGAGGTAGCGGCGCTGCCGTCTGCCTAT
CCGCCAACGAGCCACCGGTTGACGGCCTTTCTCTGCTGCTTTGCGTCCGGCTTCGACCCGTCATCCAAGCTGGGTCTGCT
GCTACGCGACATCCACACGCCTGTGCCGTCGTATGACAAGATCGGACCCAGCATGGAGCGGTTCTTCTCCCGGATTCAGG
TGGGAAAGAACGTCAAGCGTCTCAACGTAGGTTACTCTGTCCATAAGGCTCTGCAGATAGATGACCCGGAAATCTGACGT
GTCGCAGTGGTCCGTCCAGACGCACAGTGATTTGTTTATCCCCAAGGGAAACCATATTGTCGAGGGCGACGTCTTTACGG
AGGACGAAGAGATAGACATCACAAAGGTGGGCGACCGGAAGATGTCCCACGATCGAAACTGCACACTGACGAACTTGGTA
GTCCCATATGCGTGTCGAATGCCAGACGGTCACGCGGCTTCCAAAGACCGGCATCGTCCTCTTCTCCTTCAAGACATATC
TCTTCCCTATCGCTGAGATCAAGGCTGAGGGCTTAGGTCCTGGCCTGGCCGACGCTATCCAAGGCCTCAAGCAGGGCAAT
GCGCCTGGCATGTGGGTGTACAAGGGTGCCGTGCGCTGGGGCAAGGGCGTGTGCGATTATCTACGGTCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62