GenePrediction:GLEAN_1261 Details

Name: GLEAN_1261
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1721793..1722094 (+ strand)
Length: 302
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1721793..1721841 (+ strand)
Length: 49
Type: CDS
Source: GLEAN
Position: GCSC_173:1721910..1722094 (+ strand)
Length: 185
>GLEAN_1261 class=GenePrediction position=GCSC_173:1721793..1722094 (+ strand)
ATGGCTCCTTCTACATGCTGCGGCAAGGGCGGTTCTGAGTGCATCTGTGGTACGTTTACACTCTTCCCTCTGACAACACC
TCTCCTCCCTCTCTTCTCCCGCTGACCCGTACAATAGCCCAGAAGGCGACCTGCTCTTGCGGCAAGCGCTCCGCGCTCCA
GTGCGACTGCAGCAAGGCTGCATCAGAGAACTCGACGGCAGGCGACCGCTGCAGCTGCGGCCAGCGGCCTGCTGGCGCCT
GCACGTGCGAGACCAGCGCCGGCGCTTCGTCCAACGAGACCGACTTCACGACGCGCAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62