GenePrediction:GLEAN_1262 Details

Name: GLEAN_1262
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1724724..1725008 (+ strand)
Length: 285
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1724724..1724858 (+ strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_173:1724934..1725008 (+ strand)
Length: 75
>GLEAN_1262 class=GenePrediction position=GCSC_173:1724724..1725008 (+ strand)
ATGCCTGAAGGCCGCAACTCGCCCGAGCCCGAGCGCCAAACCGGCGCACAGGTGCACGACGTGATGGGATCCGGCCAGAC
TTCGTCGGATCATGACGCGAACAAGCATTCGGAACAGTCTGGCAGCAGCACCGGAGTGGAGGCAAGTCAAACGGGAGAAA
GGCGCCGAAAAAGAAAGCAAGGCAAGAGAGCTAACTCGGCTCGCATGTAGAACCTGACATCTAACCCAAAGGGTCCGTTG
GAGGACGTGGTGAAGGAGAAGTTTGACGGGAAACTGCGCGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62