GenePrediction:GLEAN_1264 Details

Name: GLEAN_1264
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1728854..1729528 (+ strand)
Length: 675
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1728854..1728958 (+ strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_173:1729027..1729418 (+ strand)
Length: 392
Type: CDS
Source: GLEAN
Position: GCSC_173:1729474..1729528 (+ strand)
Length: 55
>GLEAN_1264 class=GenePrediction position=GCSC_173:1728854..1729528 (+ strand)
ATGATGGGATCAAGGGTATCCGGCAAGGAGCTGGTCCACCAGCAGCCATCGCGGGACGAGTTCCACCGCCTGTCCGAAGA
CCAGCGCAACCAGATTACCGAGGCGGTGAGTTTCTCGAAACTTCAGAAGCTCCGGCAAACCGGACGGTTCCAATTCTGAC
TCATCTGCTTCAGTTTACTGTCTTTGATGCCGACAAGGACGGCCGCATCGACTACCACGAGTTCCGCTTCAGTCTCCGCG
CGCTCGGTTTCGACCTACCCAAGCAGGAGACGTTCTCGTATCTGACAAAGTACGCAATACCGCCGACCGCATGGCCGCGC
GAAAAGGAATGTGCGCCTATCTGGCGCGAATTCACTCTACCCGTGTTTCAGGGCATTGCCGGAAAGCTGATGGCAGAGCG
CGACCCGGATACCGAGTGCCGACGAGCCTACCATCTGTTTGACACCGAGGGCAAAGGCGTGATCACGGTGGAGGACTTGC
GGCGGGTGATGAAGGAGATCGGGCAGTCGATGGAGGAGAGCGAACTCGCGGCAATGATTAGGGAATTTGACGCAGACGGC
AAGGGGTAAGTTGCCGCGATGCCTTCCTTCTGCTGTCACATCATGCTGACACACTTTTAGAGGTATCAACGAAGAGGAAT
TTGTCAAGGTCATGATGGCCAAGCGGCAGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62