GenePrediction:GLEAN_1265 Details

Name: GLEAN_1265
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1732312..1734904 (+ strand)
Length: 2593
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1732312..1732417 (+ strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_173:1732479..1732524 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_173:1732589..1732614 (+ strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_173:1732681..1732730 (+ strand)
Length: 50
Type: CDS
Source: GLEAN
Position: GCSC_173:1732796..1732962 (+ strand)
Length: 167
Type: CDS
Source: GLEAN
Position: GCSC_173:1733020..1733053 (+ strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_173:1733429..1733983 (+ strand)
Length: 555
Type: CDS
Source: GLEAN
Position: GCSC_173:1734046..1734197 (+ strand)
Length: 152
Type: CDS
Source: GLEAN
Position: GCSC_173:1734268..1734904 (+ strand)
Length: 637
>GLEAN_1265 class=GenePrediction position=GCSC_173:1732312..1734904 (+ strand)
ATGAAGGATCCTGTTCAGCGTACTGATTCCCCTTACATCGACCCAACCGTTCAAGGACCTCAATCCAAGATCCGTACCTC
TGGACACCCCCCCAACATCAACAAAAGTAAGCCATCTCGTCAAAGACTGTCCACTGGACCTTTCCGCTTACCATTGCTTC
GTCATAGTGGCTTCCACCGTCAACAAGACCAGCCTTCACCCCAGCGGTGTTGAGTAAGTTGAACAGCATCTTATTCTTGT
CGCTGTCCCGTCCATGTTGCTAACCCGGTTTATTTAGGCCTCATCACGACCACACCGAGCTCGGTATGACAGACCATTAC
CGTGCCATCTTATAGCCATTGCCACGATCCGTACTAACAATTGCTTCAGAGGAGGAACTCTACGAGAAGGCCCACATCGA
CTATGACCGTGTTGCCATTGTACGTCTTGTTTCGTTCCTTGTTTCTATCTCTCTTTGTAAAGCCAACTGCTCATGCGACG
TCAGATCCCCAACCCGTCGGTCCCCGCTCTCTACGAGGATGCCCTGGTGTACGAGCCGGGCTCTGGCATCTCGTCCACCG
GTGCTCTGACTGCCTACTCTGGCAAGAAGACCGGTCGGTCGCCTTCTGACAAGCGAATTGTCACGGACCCCGAGTCCGAG
AAGAACATCTGGTAAGCAGCTTCACTCTCGTTTATTCTTGGCATCGATCTCATTGCTGACTCTCCCAGGTGGGGACCTGT
CAACAAGCCCATGACGCCTGAGGTAAGAATTGCTTGTCCTTCCGGCACTTGCTTCTTTTCTTCATTCCATCTCTTCTTTT
CATGCCTTTTACCTCGGCCATTGCCGACATTTCGGGACATGCATTGTTTCTCCGTATCCCCGCGGAATGGCGCTTACGTC
AGGGCAAACTCTGGGTTTCCATTTAATTGTCTCGGTTGTCATTGGGTTCCTGGACAGGTTCCGAGAATTCCCTTTCCCCG
CATTTGAGCCGCGGGATTGCAGCGCATCTTGTCCACAGGCAGATCGCAGCTACCCCACGCCGACGACAGCCGAGCTAGTG
CTTCCATGCCTCCGCCGGATCCACCAAGCCCCATTTGCACACGTGACCTCAGAGCTATGACTAACGAGGATGTCCAGGTT
TGGAAGATCAACCGCGAGCGGGCCATTGACTACCTCAACACACGCAAGCGGATCTACGTGATTGACGGTTATGCCGGCTG
GGACGAGCGGTACCGTATCCGGGTGCGGGTGGTGTGCGCACGCGCATACCACGCGCTCTTCATGCGCAACATGTTGATCC
GGCCGCCGCGCGAAGAGCTGGAGCACTTCCACCCCGACTACACCATCTACAACGCCGGCTCGTTCCCGGCCAACCGCTAC
ACCTCGGGCATGACCTCGGGCACGTCGGTGTCGATCAACTTTGCCGAGAAGGAGATGGTCATCCTCGGCACCGAGTACGC
CGGCGAGATGAAGAAGGGCGTCTTCACCGTGCTTTTCTACGAGATGCCCATCAAGCACAACGTGCTGACGCTGCACTCAT
CGGCCAACGAGGGCCGCGACGGCGATGTCACCCTCTTCTTCGGCCTGTCGGGCACGGGCAAGACCACGCTGTCGGCAGAC
CCGAACCGGCTGCTGATCGGCGACGACGAGCACTGCTGGAGCGACCGGGGCGTGTTCAACATTGAGGGAGGCGTGAGTAT
TTCCTGGATGGGGTATTTTTGTTTTCAGATCTTCAGACGCTGACAGCAGGACAGTGCTACGCCAAGTGTGTCGGCCTGAC
GCTCGAGAAGGAGCCGGACATTTTTGGGGCCATCCGCTTCGGCTCGGTGCTGGAGAACGTGGTATTCGACCCGGAGACCC
GTGTGGTCGACTACGACGACGTGACGCTGACGGAGAACACGCGCTGGTGAGTGCTCGCATGCCGGGTTGTGTCGGTACGA
TAACTACGAGGCCAATTACTAATCATCATGCTCCAGCGCCTACCCGATCGAGTACATCCAGAACGCCAAGATCCCGTGCC
TCTCGCCGTCGCACCCGAGCAACATCATCTTGCTGACGTGCGATGCGCGCGGTGTGCTGCCGCCCATCTCGAAGCTGAAC
CGGGCGCAGGTCATGTTCCACTTCATCTCCGGCTACACGTCCAAGATGGCGGGCACGGAGGTCGGCGTGACCGAGCCCGA
GGCGACGTTCTCGTCCTGCTTCGCGCAGCCGTTCCTGGCACTGCACCCGATGCGCTACGCGCAGATGCTGGCCGACAAGA
TCGACGAGCACCAGGCCAGCGCCTGGCTGCCCAACACTGGCTGGGTCGGCGCCGGGTTCGCGCAGGGCGGCAAGCGCTGC
CCGCTCAAGTATACGCGCGCCATCCTGGATGCCGTGCACTCGGGCGAGCTGGCCAAGGTCGAGTATGAGACCTACGACAT
CTTCAACCTGCAGGTGCCCAAGACCTGCCCCGGCGTGCCGTCCGAGCTGCTCAACCCCAAGGGCGCCTGGACCGCCGGCC
ACGACAGCTTCAATGCCGAGGTTCGCAAGCTTGGTGGCCTCTTCCTTGACAACTTCAAGAAGTACGCGTCTGAGGCTACC
GAGGACGTCGTCAAGGCCGGCCCCATCCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62