GenePrediction:GLEAN_1267 Details

Name: GLEAN_1267
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1739322..1741235 (+ strand)
Length: 1914
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1739322..1740044 (+ strand)
Length: 723
Type: CDS
Source: GLEAN
Position: GCSC_173:1740098..1740845 (+ strand)
Length: 748
Type: CDS
Source: GLEAN
Position: GCSC_173:1740898..1741235 (+ strand)
Length: 338
>GLEAN_1267 class=GenePrediction position=GCSC_173:1739322..1741235 (+ strand)
ATGACGACGACCGTACAGCCGTCTAGCGCGTCGTCGCTGACGGCGGCCGAGCCGGGCACGGCGGCCGCACTGCCAGAGAA
GGGCACCGGACCGGCGCTGCAGCCGGACCTGGAAGCCGGGTCGAAGCCGGCGCACCGGATCGTCAGCCACTTTCAGACGC
TGCTCCGACCGGCAGGCGTGACGCCCGAGGTGCTTGCGCACGAGTACCCTGGCCAGGGTACGGCCGAGTCGCCGTACCTT
GTCTTCTTCCTCGATGTCGACGCCCACAACCCGCAGACGCTGCCGTCGTGGCGCAAGTGGCTCTACACCCTCACCATGGC
CACGGCCACGCTGGCAATCGCCTTTGTCAGCTCAGCCTTTTCCGGTGGCATCTCCGAGATCATCCGGGAGTTCCACATCT
CGGACGAGGTTGCCATCCTGGGCATGTCGCTCTTCGTGCTCGGCTTCGCCGTCGGCCCACTCATCTGGGCCCCTATGAGC
GAGTACTTTGGTCGCCAGATGCTCTTCTTCGGCACCTACGCCATCGTCACCGCCTTCAACGCCGGTTGTGCTGGCGCCAA
GAACATCGAGACCCTCATCATCCTGCGCTTCTTCGCCGGTGCCTTCGGCTCGTCGCCCCTGACCAACGCCGGTGGCGTCA
TCGCCGACATGTTCTCCGCCAGCGAGCGTGGCATGGCCACTGCTATCTTTGCTGCCGCCCCCTTTCTCGGGTCCCTTCGC
TCGGTCCCATCTGCGCCGGCTTTCTCGGCGAAGCGGCCGGCTGGCGCTGGGTCGAGGGCCTCATGGCTGCCTTCACAGGT
GTCATGTGGATCGTCGGCACGCTCATCGTGCCTGAGACTTATGCCCCCTACCTCCTGCGCAAGCGTGCACAGGAACTCTC
GCGCCGCACCGGAAAGTTTTACGTCTCCCGCTTGGACGCCCACTACTACACCCCCGGCAAGGATGGCAGCCCGCCGCCGG
CAAAGCCCACCGTCGGCCACCAGCTCCGCACTGCTCTCTGCCGGCCCTGGATCTTGCTCTTCACCGAGCCCATCGTCTTC
GTCATCTCGCTCTACATGGCTATCATCTACGGCACCATGTACATGATGTTTGATGCCTTCCCCATCGTCTTTGAGGAGGT
CCGTGGCTGGTCGGCTGGTATCGGTGGCCTTGCTTTCCTCGGCATTGCTGTCGGTATGGTCATTGCTGTCTTCTATGCCG
GTCTCGACAACCACTTCCGCTACGCCAAGATCTCTCTTGCCCACAAGGGCGCTGCTCCTCCTGAGGCTCGCCTTTTCAGC
GGTGCCATCGGTGCTGTCCTCATTCCTGTCGGCCTCTTCTGGTTCGCATGGACCAATCGGCCGCCCGTCCACTGGGTTGT
CCCCATCATCGGCTCCGGCTTCTTCGCTGCCGGCCTTGTGCTCGTCTTCCTCAGCTTGATGAACTACTTAGTCGACACCT
ACGTCGTCTTTGCTGCTTCCTGCCTGGCTGCCAATGCTGTCCTGCGTTCGCTCTTTGGTGCTGCCTTCCCGCTGTTTACC
ACTTGTGAGTTACAGCCCGTTCCATCTCCCATCTGTTTCCCGTTCTAACCTTTTAGACATGTACCAAAACCTCGGTCTTC
ACTGGGCTGCGTCTATTCCGGCTTTCCTCGCTCTGGCCTGCTTGCCCTTCCCTTTCCTCTTCATGCGCTATGGCGAGCAG
ATTCGCATGCGCTGCAAGTTCGCTGCTGAGGCTGCTGCCATCTTGGCTCGCATGCGCCAGGGCGCCGCTCCTGTCACACC
GCCCGATGAGGATGCCGCCATCCAGGAGGTTAACGCTCACGAGCTGGAGCGCCGCCTCACTCGTGCCAGCCACGCCAGCC
GCGCCAGCCGAGCCAGCCGCATCAGCCGCCGCCTCTCGCAGGCCATCAACAGCAACGAGAAGTCGGACGCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62