GenePrediction:GLEAN_126 Details

Name: GLEAN_126
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:850234..851378 (+ strand)
Length: 1145
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:850234..850246 (+ strand)
Length: 13
Type: CDS
Source: GLEAN
Position: GCSC_179:850384..850523 (+ strand)
Length: 140
Type: CDS
Source: GLEAN
Position: GCSC_179:850593..851120 (+ strand)
Length: 528
Type: CDS
Source: GLEAN
Position: GCSC_179:851202..851378 (+ strand)
Length: 177
>GLEAN_126 class=GenePrediction position=GCSC_179:850234..851378 (+ strand)
ATGGCGACACCCCGTAAGTTGTGATGCGGGGAGGACAAAGAGGGGATGGCGTTGGGGAAACCCGGTTGGCGCAGGCGGGG
CCGCTGTGGAGGGGCCTAGACTGCGGGTGTGAGCCACAGGCTGTCATCATGGAAGCTGACCATCTCACAGTATCGGACGA
GGAGGAGCAGCGGTATACGCACCTCATCGATGCCATCCTCGAGACAGCCGATCTTCTGACGGTGACGCGGAAGAAGGTGC
GGAAGGGTCTGGAGAAGGCGCTGGGGGGAAAAGACCTGAGTGAGCAAAAGGTGAGTGGTGTCTGTCCTGCTGCCTTGTTT
CGGTTGTATGATGTCTGACCATGTCCGATGTTTGTGTAGGAGGCAATCAAGGCACTGATCGAGGCGCGCTTCGATGCTAT
CAACTCCCAGTCGCTGTCGACGCCGCCGCTGCACAACGTGAGCCCGATCGATGACGAGTTGGGCAGCGTGACGCCGTCGA
AGCGGCGCCACCCTACGGAGAGCGATAACGAGCACGACGACGCGTCCAGCCGGGCGGCGACGGAGGAGATCAACGTGGCA
CTCGACGAGATGCCAGCCAAGAAGAAGCACAAGCGATCGTCGTTGTCGATCGAGGACGCGGACGCGCGGCTGGCAGCGGA
GCTGCAGGCACAGGAGAACCGGCTGGCACGGGGCCGGACGACACGCGGTGGCAGTAGTGTGGTGAAGCCGCGTAAGAAGC
CACCGTCAAAGAAGAAGAGTGCGCCCAAAGTTAAGACTGCTGGTGGCGATGGTAGTGACGCCGATAGCGATGGCAGCGGC
GAGGTGAAGGAGAACCGTAAGACGGGTGGGTTCCAGAAGCCGTTCAACCTCAGCGACCAGCTGAGCGAGCTGGTTGGTTC
TTCGCAGGTGAGTTTCTTCCATTGCTCTGTTCGTACATGCTGCCATGTGCAAACTCGGTCTGATCAGACACAGCTCTCTC
GTCTGCAGGTGGTCAAGAAGCTCTGGGTGTACATCAAGGCCCACGACCTGCAGGATCCGCTGGACAAGCGGCAGATCCGT
TGCGACGACAAGATGCAGGCGGTGTTCCAGCAGCAGCGGGTGGGAATGTTCCAGATGAATAAGCTCCTGGGCAGTCACCT
GTATCCGGTGGAGGAGGAGGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62