GenePrediction:GLEAN_1271 Details

Name: GLEAN_1271
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1764896..1767015 (+ strand)
Length: 2120
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1764896..1764999 (+ strand)
Length: 104
Type: CDS
Source: GLEAN
Position: GCSC_173:1765067..1765638 (+ strand)
Length: 572
Type: CDS
Source: GLEAN
Position: GCSC_173:1765706..1765943 (+ strand)
Length: 238
Type: CDS
Source: GLEAN
Position: GCSC_173:1766532..1766560 (+ strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_173:1766622..1766673 (+ strand)
Length: 52
Type: CDS
Source: GLEAN
Position: GCSC_173:1766790..1766892 (+ strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_173:1766980..1767015 (+ strand)
Length: 36
>GLEAN_1271 class=GenePrediction position=GCSC_173:1764896..1767015 (+ strand)
ATGCCTGCCCACTCCAAGCCGGCGGTCATAGGGCCATGGGGAAAGGCGACGGCCGGTGCTGCTGGTGCTGTTGTTGCCAA
CGCCTTGGTGTATCCCCTCGACATGTATGCGCTTAGCTAGCTAGTCCGCCATGCTGCTGCCCGCTCTCTGCTGACAGGTC
GCCGCGTGTAGTGTCAAGACCCGGCTGCAGGTGCAGGTGAAGCAGACCATCGAGGATGACGAGAAAGGCAAAGAGGTCAC
CACCACCAGCTCCAGTGTGACACCACATTACGCCTCCACCTGGGATGCCATGACCAAGATCGTCCAGCAGGACGGTGTCC
TCGGCCTGTATGCCGGCATCAACGGCGCCCTGATCGGTGTCGCCTCGACCAACTTTGCCTACTTTTACTGGTACTCCATC
GTGCGGGCGCTGCATGAGCGTACCGCCAAGTCCGGCGCGTCGCCGTCCACCGCCGTCGAGCTGTCACTTGGCGCCACTGC
CGGTGCCATTGCGCAGATCTTCACCATCCCCGTGGCCGTCGTCACCACGCGCCAGCAGACGCAGTCCAAGGAGGAGCGAA
AGGGCCTGCTCGCCACCGCCAAGGAGGTCATCGAGAGCGAGGATGGCGTCTCTGGCCTGTGGCGCGGCCTCAAGGCCAGC
CTCGTCCTCGTCGTCAACCCGGCCATTACCTACGGCGCCTACGAGCGGTTAAAACAGGTCTTGTTTCCTGGCAGGAGTAG
CCTCCGGCCATGGGAGGCTTTTGGTGCGTCCGGTCCCATTTCTAGCTTCGTCCGGGCTCGTATTCGCCTCGCCCTGCTGA
CCAGTCACAGTCCTGGGCGCCATGTCCAAGGCCCTGGCCACTATTGCTACGCAACCCCTTATTGTGGCAAAGGTTGGCCT
GCAGTCCAAGCCACCACCGGCTCGGAATGGCAAGCCGTTCAAGAGCTTTGTCGAGGTGATGCAGTTTATCATTGCCAACG
AGGGCCCACTCGGCCTGTTCAAGGGCATCGGCCCCCAAATTCTCAAAGGCCTCTTGGTCCAGGGCTTCTTAATGATGGCC
AAGGAGAGGTATGGAGTATTTCGCAGCTTTTATTGTCGTGGTCGCTAACATTGCTGCAGGGTGGAACTTCTCTTTATTCT
GTTTGTCCGGTATCTTCGCAAGCTTCGGTCTGATCAGCTCGCTAGACTTGGTGCTGCCGCTGCTCTAAAGAACACGATTG
CACCCATTAGCATCACCAAATAAACGCATGTACATTAGGACGGATTCGACGGCATGGAGGGGGCTGAATCGTATTGTGGA
ATTGGGATGGTATAAATATCGTGGCTTGTCCGGTCACGGTCATTGGGCATCTGTTAGTGGGTTAGTTTCATTACTCCGTA
CTCCGTAGTCTTACATAGTAGAGAAATAACGCGAGCAAGCTATGTCTTATAACTTGAAGATGGGATATTAGCAAGGGCGA
TGACAAAAAGTCGGTTCCCCACACAGGGCTAAAACCGACCAGCCGTGTAGTCACGTGACATATGTGGCTGTCCCGCTTCA
AGCCACACGAATTTCGAGGTTTGCCCTTTTCTCGCACAAATCAAAATTCTCCTCCATATTCTGCCCTAGTCTTTCACTTC
CTTTCAACATAACGCTCTTCACACTTCTCGATCAAGGAACGAGAAAAAGACAGTCGCCATGGCCAGTACGTGCATCAAAG
ACGCTCGAATTTCTGCATACGCCAGTCTACTGACATTCTCCTCTAGAATCCAAGAACTCGTCGCAACACAACCAGTCGCG
CAAGGCGCACCGGAACGGGTATGTTTGGAGCCGATTTTTGATGCGAGGAGGACGAAAGACAAGCATATGATGGACAGAAA
TGGAGAGAACATTGGGACGAGAATGAAAGACTGACCGGTGACTTCACCTCGCAGCATCAAGAAGCCGAAGACGTCTCGCT
ACCCGTCGCTGAACGGTACCGACCCCAAGTTCCGGAGAAACCACAGACATGCTCTGCACGGCACTGCCCGCGCTCTGGTA
CGAGAATACCCTCTCATTCGACAATGTCCCGCAATAGCGTTATCGAGTCGGGAAAGACAGCTGTCTTGCTAACCATTTTC
ACAGAAGGAGTTTAAGGAGGGCAAGCGGGAGTCGGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62