GenePrediction:GLEAN_1272 Details

Name: GLEAN_1272
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1769431..1775650 (+ strand)
Length: 6220
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1769431..1769929 (+ strand)
Length: 499
Type: CDS
Source: GLEAN
Position: GCSC_173:1769989..1771293 (+ strand)
Length: 1305
Type: CDS
Source: GLEAN
Position: GCSC_173:1771353..1771380 (+ strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_173:1771968..1774531 (+ strand)
Length: 2564
Type: CDS
Source: GLEAN
Position: GCSC_173:1774599..1775650 (+ strand)
Length: 1052
>GLEAN_1272 class=GenePrediction position=GCSC_173:1769431..1775650 (+ strand)
ATGTCGAACCTTGCAAGCAACCGGATGAGCACACCTGAGGCCAGCCAGACGACGCTGCGGCCGCCGTCCTCACGTGCAGT
GGGCAGCAACGCCCACCTGCGGGCTTCTGCCGATGTGGCTGCCCTGACCGGAACCAGCGCAACCAGCCGGATTCGGCCAT
CGTCTGACTTTTATGGACAGACGCAGCCTAGCCAGAGCCAGTCCGGGGATTTCGATCCTCAGGAGAAGCTTGCCCAGGAG
TGGATTGCCGATATCGATCAGTACGAGACCACGCTGGAGGAGATGGCTGCGGCCACACTCGACCAGGACTTCAAGGACGA
GCTGAGCGCCATCGAACAGTGGTTTCGTGTCCTGAGCGAGGCCGAGCGTACGGCTGCGCTGTATGCCCTGCTGCAGCAGA
CGACCCAGGTGCAGATCCGGTTCTTCATCCAAGTCTTGCGGCAGATGGGTAAGAACCACCCGATGTCTGGGGTTCTCTCG
CCGTCCAATTTTGACAGGGGTTGGTTATTTCCCCTTTTTATCCTCCGCCGGCAATCTATGACTAACCGATGCCCACAGAC
CCCATGTCGAACCGGCTAAGTGACGCGATGAACAGGCTTAGTGTGGACTCGACGAGGAACTCGATGGCGCGCAACTCAGT
CCTCTCGACGAGACGGCAGTCCGGCCTAGACCCTTCGACCATCAATGCCATGTTTCCCGATGCGGCTGCTGCGATCGCGA
CGGAGAAGGCAAAGTTCACGCAGCAGACGGGCAACCCGCCTGTGTCCAACCGGAACAGCACGGTGGATCCGAGAAACTCG
CTCGTGGCGCCGACGATCACGACGTCCGGCGAGACGGCAGCTGCTAGTGCTGCGGCTGGTGGAGCTGCCAACGGCCAGGT
GCCGCCTTCGCCGTGGGGAGCTGCTCCCAGCATCCCGCCGCCATCGCCCGGCCAGCCGCCGATGGGCCAGTTCGTGCAGC
CACCGCCGTCGGCCAGCCTGCGGTCCCCTCGGCCTGCGGTGACGTCGGGCGGACAGATTCAGAGCACGACAATTTCGGCC
GACAAGCAGCCGGACTTGCCGATGCTGTCGCCGTATACGGGAGGCGGCAACTGGGCGTCGATGGTGAACACGCCGATGGT
GGCCAACTTCAACACACCGCAGCAGAGCGGCAACCAGGCCGACATGGTTGCGAACGCGACGGCCATGAAGCTTGCAGCGC
TGTCTACGGTGAACAACCGGTTTGCACTGGACGACGTGCGCAAATACCGCCGTGCGCGCTCCAACGACTCGCCCGGGGCG
CAGAACCCGCTGTCTCCGGGCGCGCCGATGCTCAACCTGCCGGGCAACACGCTTGTTATGGTCAACGAGCACGGCCAGGT
TGTGCGCGGCGACAATCTGATTGGGCTCCAGGCGCAGTCGCCGCTTGGGTTTGGTGCCCATCGGTCGCGGCCCAGTTCAC
CGGGCATTGCGATGCAGGGCAGCTTTGGTGGGATGCCGTTCACGTCGCCACAAAACAATGGATTTCTCAGCGCGTACGAT
GGATCGCCGCTCCTGACCGGTGGGATGGCTCTGGGGCTGTCGCAGTTCGGACTGGGAGGACACCATGAAGGATACCTTTC
GGACCACTCGGACATGGTGCGTGGGCGGTCGCCGCGTGGACGGCGTGGAAGCTCGAAGCCACCTGAGGATCCGACAGACC
CGACGCTGCTGCAGGATATCCCGAGCTGGCTCCGCAGCCTGCGTCTGCACAAGTACACGGACAACCTTAAGGACATGAAG
TGGACGGACCTGATCGAGCTGGATGACGCACAGCTGGAGGAGCGGGGCGTGAACGCGCTCGGGGCGCGGCGAAAGATGCT
CAAGGTGTTTGAGCAGGTGAAAGGTACGTTGTAGGCACAGGTTGTGTGGACTTGGACTTGACCATTGGCTAACTGGTTGC
AGAGGCGAAAGCGGACGGCAAGATTTCGTCGTAGGCGAGCTCTCCTGGCAATGCAAGACCGTAGGCAGTTTGCAGAGCAA
CGCCAACCAAAGCCGGTGTCATGCTGCGATGCTTGAATTTTATTTCAGTTGAATTTCTTCAGAATCTCTGACGCTTCCGT
GTGATTCGAATGCACTTATTATATTAAAAGAGGATAGGGTGGGAGAGCTAGGCTGAAAAGGTCGCAGGATGATGCTTGCA
TGCTTGGAGGATATGGGAAAGGGATGAGGATGAAAACAGTGTATAGAAGGAAGAAGGCACCGCAGGCCTAGTTCGAAGAC
TGAACGCGAGAGACGGCGTCTTGACGTGCTGGGTTAGAAGTTAGAAGTGCAATAGTGAATGTAGTGAGTTGCTGCAGAGA
GTGCGGAGTGATGATGTTAGTAAGCGACAAGGCTAGCAATTATAGCTAGCCGTACGCATAATAGAAGGCCCGCTTTTTGC
ATTTGAACGTCAACTTTGTTTCCCAGGTCCTAACAGCAGTCTTGGCAGTGCAAGACGGGGCCACAAGCTGCGGCAAGCAA
AAGATGTGAAGGGCGGCAGAAGCGACAAACTCTGGGTATCCAGTGACCAAATTTTAGCGAAGACGCAGCGTTGACGGAGA
CAGCAGCGACGATGGACGACAACGACATGGAGATGGACGATTCCACATACATGGAAGCAGGAGACTCGACGATGCATGAC
GACGAGGGGGAAGAGGTGGGCGACGACGTGTCGGACGCGGACTCGGACTACCTAGAGCTGCAGGCGGATATTGCGCGACT
GGACGCGAGCCGACAGGCGTTTCTGTCGGAGCACCTGGGACATTCGTACCGACCGTCAGACGAGGAGAAGGGCGGCGTCG
GGGGCGTCGCGGTGCGACGACGACGAGGACCACGTAAGGCAGCGGAGCCGACGGGGGAGGTCAAGCTGCGGCTACAGCAG
GCGCACCAATTGTTCATGGACCACCGGTACGAAGAGGCGCTCGATGCGCTGCACGAGATCATCCGGGTGAATGCGGAGAC
GCACTCGGCGTGGACGCTGCTGGCATCGATCAACGAGGATTTGGGGCGGCGAGACGAGGCGATCATGGCGATGGTGTTTG
CAGCACATCTGGAGCCGAAGCGGGTGGCGGGATGGCTGAGCACAGCGGACTACGCGCTGGCAGAGGCGGGCGGCGAGGAA
GACGAGGAAGAAGACGAAGAAGAAGAGGAAGGGTTAGGGGAAGAGGACGATGAGAGGGAAGGTGGGAGAGGAGGAGGGGG
GCGAAAGAAGCGGCGGCTGCAGAACCTGCAGATCGCACGGCTCTGCTACTCAGGGGCGATCCGGGCAGACAAGGACAACA
TTGCAGCGCGACTGGGAAAGGCAAACGTATGCCTAGAATTTGGGCAGGCGACAAACGCGGCGACGGAGTACGTGCGGGTG
CTAAAGCGACGGCCGTATGCGCTGCAGGTGATTCGCAACCTGGCAGAGGCATCGTACGACTCAGTGCGGGGGGAAGAGAC
GATCCGGGCGGCAGTTGCGGCATACCGACGAGCGATTGGGAACCTGCAGCGGCGAAGCCGAGCGGCAGCAGCTGCAGCAG
CAGCAGCGGAAGCGGAAGAGGGAAGGGCGGAAGGGAGAGTGGGAGGAGGAGGAGGGGGGCAGTACCAGTGGCAGCTGGTA
GAGGTGCCAGAGCTGCAAGGTGAAGACGGCGAGGTGTTCTCGTGGATGGACGTGACGATCTACGTGGAGCTGTTTGCAGC
GATGGGACGGTACGACGAGGCGATAACGGCGCTCAAGGGGCTGGCACGCTGGATGCTGGGCCGGGGAGCAGCGGACGAGG
CGGCGTTTTGGGAGCGGCAACAGCATCAGCAGCAGCTCGATGACGACTGCGAGTGGGACCGAGAGGACGAGCCACGTCGG
GTCAGACTGTCCGGATTTCAGCGCGGACGGTATCCGGGGTCGACATACGGCGAGGGTTTGCCGACGGACCTGCGGACGAA
GCTGGCGGTGTATCGACTCAAGCTGGGACACGAGGAGGAGGCGATCGAGCACCTGTTGTGGCTGGACCCTCAGGATGCCG
GAACGACGGAGACGATGCGGGCGACACCACACCTGCTCAAAGACCTGGGCATGGAGCTACACGCAGCACGACGATCAGAT
CTAGCGCTGCAGTACCTGGACCTGTACCGGATGCTGAACCGGCCGGCAATGACGTCGGGGGCGGTGGAGTACAACCAGTA
CGGGGATGTGATAGAGGGCAGTGGTGGGGGGACTGGCGGTGACGACGGATTTGACGAAGACGCCGAGGCGTTGGTGGTGC
AGGGCAAATGCAACCTAGAGCTGCACGACCAGGCAGCAGCCGAGGAGTGTTTCCTGGCGGCGATCGAGGCGGACGTGGAG
AATGTGGATGCACGGTTTGAGCTGGCCAAGATGTACGAGAAGGTGCACGAGAAGGAACAGGCGTTTATTTTGGTGAACGA
GGCGTTGTCGTTAGAAGCCCAGAGAGGAGGTCCAGAGAAGAGTGGCAGCAACATCAACATCAACGGCAACGGCAACACGA
ACGTGCAGGCCAGCGCCCATCTGCACACCAACACGAGCAAGCCGGGCGGACGGCCACGTGGCCATGCGGCGAGCCTGGAG
ACGGCCGCCTATCGGGTCTTTCTGGATGGTGATGGCAAAGTGGTGCGACGACGACGAAAGTACCGACGAGGCGATGGAAA
CAAACGGCGACGGCGCGGCGGCGATGGCGACGGCGACGACGCGGCTGGTGGCAGCGGTGGTGGCGGCGTTGACGCGGACG
GCAACCCGATAGCGCATCGCCGTGTGGTCCGAGGTCATGCTCGACGCTTCTTTGCCAGTCCGGCAGCTCAGGCCGAGTTT
GAGGCCGAGACGACGGCACGGCTGCGGGCACGCTACCAGCTCTGCCGCGAGGTCAAGGCGCGGGCGGACGGCGGCGACGC
GGCTGCGACAGCACGTTGGATGGAGGCAGCACAGGAGCTCATCGACGACTTCCGGTCGTTTCGCGAGTTTTACACGTGGG
ACAAGTACGTGCAGTTTCTGGGGTACAACAACTTTCTGCAGGACCGAGAAGGGGAAGGGGGAGGAGGGGGGGGAGGAATT
ATGCCAGCAGGGACAGACACAGGCAGTGATCTGACAGCCTTGGCCGAGAGGCTGAAACAGAGTGAGTGGATCGAGAAAGT
GAAGGAAGAATGAAGGGACCGAAAAAAACGATGATGCTGACTAATCAGATCTCACCCCAACCGACGCCATTGACAAGACG
CCAGCAGCACGACGCGACTTCCGTGGCATTCCGTTTGACGACTGGCTGGCGCTCTTCCTCGAGTATGCCCTGGGCCTGGC
ACACAATGGACGGGCGGCTGAGGCGTACGCGGTCTGCCAGGCAGCCCACGACTCGACGGTGTATCGACAGCACGACAGCG
CCTTTCTGATCCACCTGACCTGGGCCTCGTGCGCCGTACGGGCTGGTGACGAGCAGACGTGCGTGGCTGTGGCCCGTTAC
TTTATGCGCGACCGGCCGTTTACGACCGACTGCTACCGTCTGTTTGCCGCCATGTGTCGGCTGTGTCGATCGTCTACGCC
GTCGGCCTCATCGGCCTCGTCTTCCACCTCGTCATCGGCCTCGTCTCTGGCCTGGTTCAGCGCCAGTCCGGCACAAAAGT
ACATTTTGCGACAGATCCGGCAGCGTGACGAGACGCTGGCACGCCAGGCCCGCGAGGCCGGACTGGACCCGACCGGCGCA
GACGCGGCTGCTGGCCTAGACGTCTGTCTTCTCGTCACCTACGGCCACATCCTGTTCGCGTCGGCCAGCTACCACTTTGC
GCTCAACTACTACCAGCGTGCCCTGGCTGTCGACCCGGGCAGTCCGGCCATCAGCCTCTGCATCGGGCTCTCGTACGTGC
ACTGGGCGCTCAAGCGACAGGCCGAGAACCGCCAGTACCTGTTGATGCAGGGGCTCGGCTTCATCTTCCGCTATGTCGGA
CGGCGGACGTGCAGCGAGGCTGGGTCCAACCCCCGATCGGCCATCCACGCCCGCCGCGAGGCCTGCTACAATGTCGCCCG
CACATACCACCTGCTGGGGCTGCACGCCCTGGCGGCCGAGTACTACGGCAAGGTGCTGGCAGAAACGGGCGACGATGAGG
CTGTGACGGGGAAAGACGGCGAGCTGGAGCTGAGACCAGACCTCCGGACGGAAGCGGCCTACAACCTGCGGACGTACTAC
CTGCTGGCAGGCAACCAGAAGGCAGCCATGGCGATTGCACGGACATATCTGGTGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62