GenePrediction:GLEAN_1273 Details

Name: GLEAN_1273
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1776043..1777101 (+ strand)
Length: 1059
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1776043..1776105 (+ strand)
Length: 63
Type: CDS
Source: GLEAN
Position: GCSC_173:1776165..1776896 (+ strand)
Length: 732
Type: CDS
Source: GLEAN
Position: GCSC_173:1776964..1777101 (+ strand)
Length: 138
>GLEAN_1273 class=GenePrediction position=GCSC_173:1776043..1777101 (+ strand)
ATGTCTGGCCGTCCCATCTTCGTGGCCACCCATCCGCGGTCCTGTTCCACGGCCTTTGAGCGGGTACGCCCAGCTTCAGC
TTCCAACCTGCCGAGAACTCTGTCTCTGCTGACCAAGACCAGGTATTTCTGACCCGTTCCGACGACATCGCCTGTGCCCA
TGAGCCCTTTGGCGATGCCTTCTACTACGGGCCCGAGCGCCTGGGCCATCGCTTCGCCGAGGATGATGAGTCGCGCCTCC
GCAGCGGCTTTGCCGACGTCACCTACAAGGACGTCCTCGACCGGTTTGCCGACAGCAACAATGCCCACAAGCGCGTCTTC
ATCAAGGACATGGCCTACTACCTGATGCCTCCTCACAGCCAGTCAGCCTCGGTGGTGCCGTCACTGGCTGCCAGTTCTGT
TGGCTCCCACGACCAGAATCCGTCCGTCATCCCGCTGGCCATCCTTCGCCGCTTCCACTTTGCCTTTCTCATCCGCCATC
CCCGTCACTCCATCCCGTCCTACTACCGCTGCACCGTCCCGCCGCTGGTCCAGACGACCGAGTTCCACGACTTTCTCACC
TGCGAGGCTGGCTACGCCGAGCTGCGCCGTCTGTTCGATTACCTGCGCGCCCAGCGCGTCGTCGGCGGCCCTGACGTCCC
CATCGTCGTCATTGACGCCGACGACCTGCTCGACCGGCCTACCGAGGCCATTGACGCCTTCTGTCGCCACGTCGGCCTCG
ACTTCACCCCCGACATGATGCGCTGGGAGGACGACAAGAACCAGCAGATCGCTGCGACCGCGTTCGAAAAGTGGGCTGGC
TTCCACGACGACGCGCTCGCTAGCACTGGGCTCAAGGCTCGGATCAGCCATCGGGTATGTCGGGCGACAGCCCGTTCCGC
CCGTGTCCTCGTTGCCACAGCTAACCGTACCCCACGCGCAGAAACAGCTTACGGAGGAGGAGGAGGACGAGCAGTGGAAG
CAAAAGTACGGCGACAAGGGCCAGAAACTCATCCGCAAGTGCGTCACGGCCAATACGGAAGACTATGAGTACCTCAAGTC
CTTTTCACTCAAGTTTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62