GenePrediction:GLEAN_1276 Details

Name: GLEAN_1276
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1802036..1802727 (+ strand)
Length: 692
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1802036..1802121 (+ strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_173:1802163..1802727 (+ strand)
Length: 565
>GLEAN_1276 class=GenePrediction position=GCSC_173:1802036..1802727 (+ strand)
ATGTCCCGCCGTCCAAGGGCAAACGCAACCGGCGGCGACAACGGCAGAAGCAACAAGGAGCTGCCGAATCGGGAGACACT
CCAGATGTAACAGCCAGGCCAGCAGCACCCTCAGGGCAACCAACTAGGCCAGAAAATGTGCCGCCACTTCCAGAGCTGGC
TGCATTCGTCGACATTGGACTGACCAAGATCACTCGGGTACTAGCGGAGAACGCCTGTCCATCTTTACAGACAGACAAGG
ACGGGGGACATGCAGCGCAGAGCGCGAGCACGCAGCCCCCAGAATTGTCGCCATATTCAATTATTTTTGTTGCCCGGTCG
GGCCATCCCTCTGTGTTTTACTCTCACTTTCCCCAGATGGTGGCCGTCGCTTCACACAGCCGTAAGAGAACCAGCACCGA
CTCCCTTGATGCCTGTGTTGGATCGCCGTCCTCTATAATGGACCCGATTCGCCTTGTTGGGTTCTCGCATGGTTGTGAGG
ACAGACTAAGCGCCTGTCTTGGGATTCCACATGTATCTAGTATCGCCTTGCGGGCTGGGGCCACGCAGTCACAGGGGCTG
GTTGACTTTGTTCGTGGCCGCGTGCCGCCAGTCGAGATTCAATGGTTGCAGGAGGCACGGGCAGGTGATTACCGTAAGAC
GCATATTCACATGGCTGAGGTTACTGTTGGTCCGAAGAAGAAGAAGGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62