GenePrediction:GLEAN_1277 Details

Name: GLEAN_1277
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1803958..1807358 (+ strand)
Length: 3401
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1803958..1804132 (+ strand)
Length: 175
Type: CDS
Source: GLEAN
Position: GCSC_173:1804206..1804719 (+ strand)
Length: 514
Type: CDS
Source: GLEAN
Position: GCSC_173:1805205..1805507 (+ strand)
Length: 303
Type: CDS
Source: GLEAN
Position: GCSC_173:1805586..1807112 (+ strand)
Length: 1527
Type: CDS
Source: GLEAN
Position: GCSC_173:1807178..1807358 (+ strand)
Length: 181
>GLEAN_1277 class=GenePrediction position=GCSC_173:1803958..1807358 (+ strand)
ATGGGCCCAGCACCGGTTAAGAAGAAACAGACGGCCGCTGGCGAGCGGTCTAGCGATACCTGGAAACCTATGATCACGTA
TTACGGCGATGAGTCCCAAGCGAAAGATACACATGCTAGTTCCCAGCCTCGCAGTGGCAGCAATTTGAACGTAGATAGTA
CTCAGGTCAAACCGGGTGAGATTGAGCCTCGTACTTGAGGTGACACCCAACATAGGCCGTTTTGAGACTGACGTGTTTTA
TAACTCAGATGAGAACCTACAGCCTCGTGACAAGAACATGGCCCAGACTACGACTCCCGGAGATACTGCAAGGATGCTGG
CGGAAGATTTGATTGACTTTTCTCCATCTGCCTTGGCGCATGTGCAAGAAAAATACAATAGGGGCACGGCCCATCCGATG
TCGGGCAACGCGGATCTCCTGTCTGACGCCTTCGGTGATGTGTCTCTGTCAGGGAGTAAGATGGGATTTGAGGCGATGCT
TCCCAACTCCGGAGGTGAAAGTACAAACGAGAGAGGTATGTTTGTCCCTCCCAATGCTCTTGAAGGTGTGCGGGAAGCCC
TCGAAATCAACAAAGCCGGTAAGGCTGTAACCTGGAACTGGTCGGAAGAGCCCCCACAGGTTCGAGAGGTCACAAGGGAA
GAATGCGAGGAGCTTCAGCCTACACCTGCTTTTGATGAGTTCATGGTTCAGCGTTGGGACCGGCCTTGGCTCGCACCCAA
AGTGTCGAACGGGAGTCAGGCAACGCCTATGGAGATTGACAGGTATGTGGTCAACTAAGAAATGTATTGGTATAATGGTC
ATTGACATTCGTACATAGTCGCCCAGCTCCTGTACGGAATCGTGGCCTTCAAGGCTCGCGTCACAATAAGTAGGGGCAGT
TCCAGACTATAATGCGCTCGTAAGCGGCGGCATAGTTTTGGGGAAGCAGAGAGGAGCGGATACTATTGGAAGTGGCCTCT
GCACCAATTGAAGGGAAAGGGATGAGATTCACCATAGGAGGAAAGCAGACAGGTGATATAATCGAGATAACCTGTATTTA
TATTGGCTGGAGTCTTCCTATCACATGATCGGCTCGACATGACACTTCGAGTTGCAGGCAGCTAGCACAAACGCACAGAT
ATTAGCAGAGAATCGATATATAACCGTATTTTTGAAAGTGTTTATTCTTACATTATCTTTAATAATGTGGTAGTTTCACC
CTTTAAGCAGAGCAGGTGCTGTCGATGTGAATGGGATGACTAAGCAGAAATGGCAGTTTCAGCGCTAATGCAAAAAAGTT
GAATCGGTACATCGGCGAAACGGTTACAAAAGCGACAGAGTCAACGGCAGCAAAAGCCAGGGATGCGGTTGGTTCACAAA
CTTGTACCATGGAGGCCGACAACATTAGCCTCAGTGCCACAGGCACCGCTGGTGTGCCTGCATCGAGCAAGACTGCAGAC
ACGGCAGCAGCAGCGACAACAGCCAAGTGCAATGCAGAGAATGACGAGCAGCGCGATTCGACTCAGCGGGGAGGCAACGA
GCGGCAGAGCAGTGGGGGGAGAGACGGACAGTATGTAGGCAGCAGAAAATCCTTGGAGAAGGACGATTGTGTGTTCTGTG
GTTTGTTGGCTGACTCTGAGGTATGCAGACAACGTGACAGAAAGCAGGGACAAGGAAATGTAGGCAAGAAGCCGAGGAGA
GGTCGTGACAGCAACGGGACATGGAACAAGAGCGACCGAGATGGGCGGCCGAAGAAGCGGCCACGATTCGAGTGGGAGGA
CCGGGGGGGCAACGGCGGCAACGGCAGTCAAGGTGGCGAGGGAGGTGAAGGCGAGCAGCGACGTTCGAACATGAGAATTC
CGTTCAGCGCGGAAGAGATTGCGGCAGAGGAGCGGCGTCCAAAGCGCAAGGTGGCAGTGATGATTGGATATGCCGGGACA
GGGTACCGGGGAATGCAGATCAACCACGACGAGAAGACGATTGAGGGCGACCTGTTTGCAGCGTTTGTGGCGGCGGGAGC
GATTGCCAAGACGAACGCAGACGACCCGAAGAAGTCGAGCCTGGTGCGATGTGCGCGCACAGACAAGGGGGTTCACGCGG
CCGGCAACGTGATCTCGCTCAAGCTGATTGTGGAGGATGCCGACGTGGTGGAGCGGATCAACGCCCACCTGCCGCCGCAG
ATCCGAGTCTGGGGCATCCAGCGGACGATCAACAGCTTCAGCTGCTACCAGGCGTGCGACTCGCGCTGGTACGAGTACCT
GCTGCCGAGCTACGCGCTGCTGCCGCCACACCCGGACAGTTTCCTGGGCCGCGAGATGGTGGCGTCGGCACGGCGGGCAG
ACGCGGCCGAGGGCGCAGTCGGCGGCATGTACGACGACATGGTACACCGTCTCGAGGACGTGCGCGACTTCTGGTCGGAC
GTCGAGCGCGATGTGGTGACGCCCATCCTGGACGGCCTAGACGCCGAAGTGCGGCGGCTGGTGGTCGAGCAGCTGCACGC
GACCGACTTCCGCACGCTTGGACACCGCAGCCTAGACGACATTGAGAAGACGGTCGAAGAAGCGGCAAAACCGGCGGCGG
AACTAACAGCCACGGCGCCCGAGACGCCGACCAAGGCGGCCGTGGACCAGGTGCTGCGCGAGATCAAAACGGCCTATGTG
GCGGCTAAGCGACGGTATCGGATCACGCCGACACGGCTCGCACGGCTGCAGGAGGCGCTGTCGATGTACGAGGGCACGAG
CAACTTCCACAACTACACGGTGCAGAAGTCGTTCAAGGACGCGTCGGCCAAACGGCACATCAAGTCGTTTGTGGTCAACC
CGGAGCCGATCCAGATGCGCGACACGCAGTGGCTCTCGCTGCGCGTGCACGGCCAGAGCTTCATGATGCACCAGATCCGC
AAGATGGTAGCCATGGCGGTGATGCTGACACGCTGCGGCACGGCGCCAGGCCCGGCCATGAAGCTGAGCTATGGGCCGCG
GCGCATCAGCATTCCGCGGGCGCCCGGCTTCGGCCTGCTGCTCGAGCGACCCGTCTTTGACAGCTACAACCTGCGGGCCC
AGGCCAACTTTGGCAAGGAGCCCATCGATTTTGACTCGTACGGCGCTGCTTTCCGCACCTTCAAAGACGAGCAGATCTAC
GCGCGGATTTGGGATGTCGAGGAGAGCCAGAACCTGTACGTTTTGTTTTTCGTGTTTGTTGTCTGCGTATTCGTCTCCAT
TTTCGCCACTGACCATCCAGCTTCCACGCTTTCTTCCACCAGCTGGACAACTACAACACCAGCTACTACATGTGGGCCAT
ACCCGGCGGCTTCGACGCGGCCTTTGAGCGCTTCGGCCACGGCCTGTCTGGACCACAGCCGGCTGCTCTTCCCGGGGACG
AAGGCGACGAGGTTGCCGAAGGAGAGGAGGGTGACGGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62