GenePrediction:GLEAN_1278 Details

Name: GLEAN_1278
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1812784..1814311 (+ strand)
Length: 1528
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1812784..1812801 (+ strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_173:1812967..1813067 (+ strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_173:1813141..1813178 (+ strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_173:1813250..1813327 (+ strand)
Length: 78
Type: CDS
Source: GLEAN
Position: GCSC_173:1813401..1813867 (+ strand)
Length: 467
Type: CDS
Source: GLEAN
Position: GCSC_173:1813979..1814311 (+ strand)
Length: 333
>GLEAN_1278 class=GenePrediction position=GCSC_173:1812784..1814311 (+ strand)
ATGCCCAGCTGCTACCAGGTAAGTGTTCGCGATTGGCCTCATGTCCCACGCTAACATGTGTCACCGCCCGGCAAAATATG
TTACCGCCAATTTTTGTTAACATTTTTTCTGCAGGCCCATATTTTTTTTGCGTGGAAATTTGCAAGGCATCTATCTGCCA
TCTCGCTTTGCTTCTACCTTCAGGACAGCACTACACCCGACAATTGGGGGCACTCCACAGCCATGGCGTCCGACGAGATC
ATCTGGGGCATTATTGACAAGCAGTTCTGCTCGTACAAGCTCAAGTGCGTTTCGCTTTCCGCCGCAAAACGGATGGACGA
AATCCGAATGCTAATTGATATTCCTTTCCCATTTTAGAGCTCCAAGTGGTCAGGGTTTCTGCCACAATGAATTCAGTACG
TCTACGCTGCACATATCAAACTTCGATCCTGCTGTGCTTTTTCCCCGACTAACAGGCCGTTCCCAGATGTTACCGGTATC
TGCTCGCGGCAGTCCTGCCCGCTTGCCAACTCTCGATATGCCACCGTCCGAGCGGATCCTGAATGTGTGTTTTTTTTCTC
TCCAGCCCCGGTGTCTTCCATCTTATCAAGCATCTAACAGCCGCTCTTTCTTGCTAGCCGGCCGGATATACCTCTACATG
AAGACGGTGGAGCGGGCGCATCTGCCTTCGAAGCTGTGGGAACGGATACGGTTGTCTCAGAACTATGCCGAGGCGCTATC
GCAGATCGACACCCGGCTCATCTACTGGCCCAAGTTCATGACACACAAGTGCAAGCAGCGTCTGACGCGGCTGACACAGG
TGGCAATCCGCATGCGCCGTATTGCCAAGGAAGAAGAGCGGTTGGGTGAGCGGCTGGTGCCGAAGTTGGCGCCCAAGGTC
CGGCACCGCGAGAAGGCGCGTGAGCGCAAGGCGGAGGCAGCGGCGCAGCTAGAGAAGACGATTGAGCGCGAGCTGCTGGA
GCGGCTGCGGTCTGGCACCTACGGCCACCAGCCGCTCAACGTGAGCGAGACCATCTGGAAGAAGGTCCTCGTGGCGATGG
AGCGGGAAGGTGGTGCGGTCCGGGACAAGGACATGGACAAGGGCGTCGACTCGGAAGAGGAGGACGAGGAGTACGAGGAC
GAAGAGGAAGAGGAGCTTGACTACGAGCTGGAGGGCAAGGCAAAGTCAAAGGCGACGAACAAGCTGGCTGTGCAGAATGG
AGACGAAGATGACCTGCTGGGCGACGTGGAGTACGTCAGCGACGTGGACGAGAGCGAGGACGACCTCGGCGATATCGAGG
ATTGGATCGGCGACGGCTACGGCGACGACAGCGGCAGCGATGATGAGGATGAGGACGATGAGGACGAGGACGAGGATGAG
GACGACTCGGAAGACAGCGCCACAAAGAAGAAGAGCAAGACCAAGGCGGGCGACAAGCGCAAGCGTGGCCGCGTTGTCCG
GCAGCCGCTCAAGGTGGCCAAGCAGCCGCAGAAGAAGATGAAGCAGATGGTTGAGTACCCGAGCAAGACGGCGGCACTAG
ACTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62