GenePrediction:GLEAN_1279 Details

Name: GLEAN_1279
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1816488..1817377 (+ strand)
Length: 890
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1816488..1816602 (+ strand)
Length: 115
Type: CDS
Source: GLEAN
Position: GCSC_173:1816659..1817161 (+ strand)
Length: 503
Type: CDS
Source: GLEAN
Position: GCSC_173:1817219..1817377 (+ strand)
Length: 159
>GLEAN_1279 class=GenePrediction position=GCSC_173:1816488..1817377 (+ strand)
ATGCACTCCGCTACTCTTATGTCTGTTGCCGCCTTCCTGGCTGGCGTGAGCGCACACGGTGTTATCCTCGCTGCTCAGGG
TGATGCGGGTTCGCCCGCCAGTGTTGGCTTCCAGGGTACGTGATGTATGCCAGATAAAATTGGCCGAATCGATGCTAACG
CGGTCTTCCAGTCAACAACGCCCTCCCGCGCAACTGCACGACCATCTCGCCGTGCCAGCAGGACACGACGCTGATCCGCG
ATGCCGAGATTGCTGCCGGCACCGTCACCGAGTGTGGCCGGACTGAGCTGACGGGCAACATTGACGTCAAGACCAGCACC
GAAGACGCCATCAGCTCTGGTGCTGTCACGTCGGTCGCTGCCGGCTCTCAGCTCACCATCACCATCCACCAGGTCAACGC
CGACGGCGCTGGCCCCTACAGCTGCGATCTCGACGAGGCCAGCGACTCTGGCGTCATGTCTCACAACCTGACCGTGGCAA
ACAACATCCCCGGCACAAACGGTCTGTCGCTGGCCAAGGAGCAGGATTTCAACATCACCGTCACCATGCCCTCGACGCTG
AACTGCAGCGGTGGCTCTACCGGAAATGTGTGCACTGTTCGCTGCCGCAACAACGCTGCTGCCGGTCCCTTTGGCGGCTG
CTTCGCCGTCCAGCAGACCGATGCCACTGCCGCTGTAAGATAGCCCTTTCCCAACCCGAGATCTGCAAACACATTTGCTA
ACATACCAAAGGCCGCCACCACGACATCATCTTCTGCCAAGGCTTCCAAGACAAAGGGCTCCTCGGCGACCAGCACGGGC
ACCAAGAAGGGCAAGAACAACAACGCACGGGACCTTCTGTCCAACAGCATGCGCTGGGCAAAGCGTGCTCTTCTGGAGAA
CGACTCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62