GenePrediction:GLEAN_127 Details

Name: GLEAN_127
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:851629..854814 (+ strand)
Length: 3186
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:851629..851776 (+ strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_179:851992..852184 (+ strand)
Length: 193
Type: CDS
Source: GLEAN
Position: GCSC_179:852462..854814 (+ strand)
Length: 2353
>GLEAN_127 class=GenePrediction position=GCSC_179:851629..854814 (+ strand)
ATGCAGAGCGGAATGGTCCAATCACAGACGTCGGTTGCAGCTCAGCCGCGCGCCGAAAATTGTCGAGCGGTTGGGGCGGT
GTGGAATTGCCAGCAGCGGTCACCGGGCAACAAGGCTGAGGGCCGCTGCCGGATGACACATATGGGGAGTGGGTCGTATT
ATTTGTCAGCCTTTTGTCGGTAGGTTTGCCCCTCGTGAACTGGTCCGTGCGCGAGGACTTGTGCGGCTGTCCGTTGTGGG
AAACGGCCTTGTCAGAAAAACTTCGTCTGTAAATTTTTCTGCACGCAAGCTGTTTTCTTTCAGAACGTGCCAGCCGGTTT
CTGAACATCGCCCTTTTGCCACGAAACGTGCGTTTGTGTACAGATTCGACTACCTTTGATCGACCAAAGTGCGTGCCGCA
AACGTACAGTGTTCTCCGTCTACGATCGACCAACGTGCAGATCGCGGGAAGACTACGTGAGAACGACAAACTGGTGGCAA
ACGAGTCCAAGGAGACGCGGCGGATCTGTGCAACGAGCGATGGCTTCGACAGGAGGGGGAAACGCAGCGGCAGGCGGTAA
CGGAGGCGAGGGCAGTTCAGGCCCGAGAGCAAGAGGCGAGGGCAACCGAGGAGACCGACAGCGAGGTGGGCGAGGCGGGC
GAGGACGGGGTCGTGGTGGCAATGGTGGAGGCAGTGGTGAGAATCGGGGAGGTGGTGAGAGTCGGGGAGGTGGTGAGAGT
CGGGGAGGTGGTGAGAACCGGAGACGAGGAGGACGACGTGGAGGACACAACAACGGCCATGCAGCAGCAACAGAAGAATC
AGTAACAGCAACAGCATCAGCAGCAGGAAGCAGAGGCAAGGATGCGCGTCTGCTGGCACCAGAGACGGAGACAGACGGCG
AGGAGGCGGAGGTGTGTTTCATCTGCGCCAACCCGGTGATCCACCAGTCGATTGCGCCGTGCAATCACGTGACGTGCCAC
ATCTGCGCGCTGCGGATGCGGGCGCTGTACCGAAACAAGGACTGTCCGCACTGCCGGACGGCGGCACCGTATGTGATCTT
CACGGACGACGTGACGAAGCGGTACGAGGAGTACGGAGCGGGCGACATCACGACGACGGACGAGACGAGCGGGATTCGGT
ACAGCAACGAAGACATTGTGGGCGACACGGTGTTGCTGTTGCGATACAACTGTCCGGACGAGGCGTGTGATTATGCCGGA
TTCGGGTGGCCGGACCTGCATCGCCACGTGCGGGAGGTGCACCACAAGAAGATGTGTGACCTGTGCACGCGCAACAAGAA
GGTGTTCACGCACGAGCACGAGCTGTTCACGGACAAGGGCCTGGACCGGCACATGCGGAACGGCGATGACCGGCCAGGAG
CAGTGGACCAGACCGGGTTCAAGGGGCACCCGCTGTGTGGCTTCTGTGGCGAGCGGTTTTACGATGACGACAAGCTGTAC
GAGCACTGCCGCAACAAGCACGAGCGGTGTTTTATCTGCGACCGGCGCGATGCTCGGCAGCCGCACTACTACCGCAACTA
CGACGCGCTGGAAGAACATTTCCGGCGTGACCACTACCTCTGCATCGACCGCGAGTGCATGGACAAGAAGTTTGTCGTCT
TCGAGTCCGAGATGGATCTCAAGGCGCACCAGCTGGAGGAGCACGGCAACACGCTGAGCAAGGACGTGCGGCGGGACGTG
CAGGTGGTCAGCCTGTCGGACTTTGACTACCGGCCGGCGTACCAGAACAACGGGGGACGGGGTGGCGAGAGGGGAGGCGG
AGGACGGAATCACGATGGCCGAAGCGGACGGGGACGCGATCCCAACGCAGAACTGCCGCTAGCCGTGGGGCCTCCACAGT
CGATGCGCCGAGACGAGATTGCTTACCAGCGGCAGCGGCAGCTGGAGGTGCAGTCGGCGCAGACGGTGACGACGAGGACG
TTTGGAAGCCGGTTGACACCAAGTGGAGGTGGCGGAGGTGGTGGAGGTGGTGGAAGTGGTGGAGGATCCTCTTCATCCAG
GCCATCTCGACCGAAAGCATCGACACCAGATCCTTTAGCAGACCCGCTACAAGGTCTCAGTCCAGCCGAGGTGGCCAGCC
TGACGCCACAGGAGCGAGCACGCCGCGTACGTCACGGCGCCGTGTTGGAGCGGGCGGCCAACCTGCTGGCCAACGATGCC
GGCAAGGTGCAGTCGTTCCGGGCGGAGCTGGCGGCGTTTCGCAGTGGTGCCGCCACGGCTGCACAGCTGGTAGACGGTCT
GGCCGGCCTTCTGGCAGACACGACGAGCCCGACGGCCCTGGGCAGCCTGGTGCGTGAGGTTGCCGACCTGTACGAGGAAC
CGGGGCGAGCCGACGCGCTGCGACAGGCATGGCAGAACCGGCGGGCTGTGACGGCAGCGACAGGAGCCAGCAGCAGCAGC
GTCCAGCCGGTCGACGACTACCCGTCGCTGCCAGGCCTCGGCGGCATGCACGGGGCGACGACATCGACGAGCGGCTGGGC
CGGCGCGGCAGCAGTATCGCCATCCATCCGAATACCGGCATCGTCGGGTGGTGGACAGCACTCGACGCGGGTGCTGCGAC
TGAAGCACAGCACGCGGCCCGGCGCAGCAGCAGTGGCAGCTGCTGCGGCAACAGCACCGTCGACCGGTCCGGCTGGCCGT
ATCGTGCCGGGTGCTACTTGGACGGTCCCGTCGTCTGGACGTCAGGCCAGCGCCGGCACCACTAGCAACAGCAGCAGTCG
GCCGTCGGCATCGCCAGCACCAGCCTCGTCGGCCGCGTTTCCGGCACTGCCGTCCACCAAGAAGGCAAACAGCACTCCAA
CGCTCTCGTGGCTCGGCGCGTCGGGTTCTTCGTCGACAGCAGCACCGGCAGCGTCCTCCTCGACTGCTGCCCGTATCGGC
GGCAGCAGCAGCAGCAGCTCCAGCAGCCGACCCCACCAGCGGCCGCCCGGCGAGGACGCGTTTCCGGCTCTGCCGGCTGC
GCCGAAACCGCTGACGACCATCTTTGGGTACGGACGAGGCGCCGTGCGGCGTGACGTCGGCGGCCGCGACACCGGCTTCT
CCTGGGGCGACGGCGAGACAGCAGGCGGTGCTGGTGGTGGCGACGTGGCCGCCGAGGCAGACGATGATGTCGGTGGTGGC
AGCGGTAACGGAAAGGGCAAGAAGAAGGGCCGGCAGGGAAAGAAGGTGCTGGTGTCGTGGGGATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62