GenePrediction:GLEAN_1281 Details

Name: GLEAN_1281
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1831287..1833867 (+ strand)
Length: 2581
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1831287..1833311 (+ strand)
Length: 2025
Type: CDS
Source: GLEAN
Position: GCSC_173:1833454..1833867 (+ strand)
Length: 414
>GLEAN_1281 class=GenePrediction position=GCSC_173:1831287..1833867 (+ strand)
ATGCCTTACACGCCTCCTCAACGTTCTCCCGCTTCGTCCGCTGCCTCGACACCGACAGTGAGCCGCCGATCTTCTTTCAA
TGACAGCAGACCCGTTCACACAAACCGTCCGAGCCTCCCCCGCTCCTCTTCTTATCTAGCACGGCACAAACGGGCACTTT
CGGCTCCTACCATTGGTGCTGCTGCCCAACCGACCCCACGAGACACCTCTGAAGATCTGAAGGGCATGGTTTCCGTATGC
CGTCCTGACGGCCAAGATGACATCTACATTGGCAGGAGTGTCTGCCAGTCGCCGCCACCAGTGACGGGGGAGCGCCAGGG
TATGCCATCCGGTGCCGTGCTTTCTCCGCCCGAGTCACCACACAGCAGCAGCGATGACGAAGACCGGAGGGAAGGTGTGC
GTGGCCGCCAGATCGAAAACACCTATGAGCTGAAGCAACTGCATGAAGCTATCAGCCAACTGCCCAAGCAGCGCCGTGAG
AGCTCACCCAGCGATACATCAAGTGTCGATGCTCAGGTCTCTCGCCGGGACCTGGCGCCATTCAGCTTCAGCACCAGCTC
ACTAGATCAGCTCGCACGGAGAAGCGCTTTGATTCAGCGCAGCGGCAGCAGCAGCGGCCGGCGTGTGTCTCATGTCCGCT
CTGCAACGGAGCCGAACGTGGTAGTGACACCGGCCGGGGGCTCGGTGATCGGTTCTGATGATGAGAACGATCTGGACATG
CACAAGCCGCCAATGGTACGAAAGAAGTCGGGCGAGCTGGTACGGCCGGCCCTTCGCTTTAGCACTGGCCGCAGACCTTC
TAGTGTGCCTTGGACTCCGACTTTCTCCAAGGCTGTTCATTTCGACTCCCACCTGGAACATGTTCGCCACTTCCTCCAAG
TCGATCGGCCGCTTGCTGTCAGTGCAGGCTCTTCGCCAGTCGACACCTACGACAGCGAGTCGGAATACCCCTTCAACAGC
AGCATCGGGATGCAGAAGCAACAGGGCCAGCGCCATGGCCCGGTGCATGAGTGGGAGATGACGCTGACCAAGTTCCCCGC
CGAGACGGCTGTCCGCATGGAGTTGCCTGCTCGACTGGAGCGTGTTTGGTTGTCGGCGGACCAGAAGTGCCTTCACGGCT
CTGTGGCTGTGGCCAACCTTGCCTTTTCCAAACAGGTTGTTTGCCGATTTACGCTTGACTACTGGAAGACAACGTCCGAG
GTTGCAGCCGAGTATTCGGCCGAGATTGTTCCTCGAGTGTCCACCATTGGCCACGACAGGTTCAACTTCACGATCAGGCT
GTCTGACATGGCACACCTCGAGTCCAAGACGCTGTTCTTCTGTATTAGGTACACCGTCGGCGGCAAGGAGTACTGGGACA
ACAACGGTGGCAGCAACTTCCAAGTCGACTTCAAGAAGAAGATGCTCCCTGTCAATGGCAAGGCCGGACTCCAGACATCC
AACGGGCTGCCCCGCAGCAGACGGCGGGCGAGCTCCTCCGTGGCGGCTCCTCGTCCCATCTCCATGCCGGCCAGTCTGGA
CGACTTCAATGACGGCGCCAATCTGATGTTCGACCGCTCTCTTCAGGATTACCTCGGCGAGCCGTTCCCTGCTCTGCGAC
TGAAGTCGCCAAAGTCGTCAGCGCCGACGTCAGACGTGCCGAGCGACAACCTGGGCAGCAACTTGTCAGTGCCCAGCGGG
CTGGCCTTCGCCAACCGCTACGACTTCAGCGCTTCGCTCAGCGCTGTCATGCAGGCAGCCAAGGACTCGCTGCCCAGCTC
CAGTGAGCTGACGATGAAGCCAAATCGCAAGCTGAAAGTCTCGGTACCTAAAACTACTTTTGACTTTTCTGCTGCTGCTC
CACCATCGCTTCCTGCAAAGCCAGTGGTGGCTTCGAAGGAGCGATTTGTGACGCCGGTGCCTGCGGGCCCAACGGTCCGC
GACGTGAAGACTACACAAGCGCCCAACGCTGCTGCAGCTGCGGCGCATGGTCAGGGTAGCATCGCATCCAAGTCGTATGA
CGAGATTGTCAGCAAGTATTGTTTCGTACGTACCTCGAGCGGAACATCTCACCACCGTTCTCAACTCTCCAATGCAACAA
AAACAGGAAAAAGAAACTGACCAAGCATTTTACTTGTTACAGTATGTACCAAATCAAATCTCTCAAGCAAGGGACGCACC
CTCACAGGTTGGGCAGATTAATGGCGCTGCCGGTGAGGTTGCCAGCCTGGCCAACTCGACGCCGCCGTCATCTTCTGAAG
GCAGCCCAATCCTGATGGGTGGCGGCCTGCAGCGGCACCCAGCGACGGCCCTCAGGCATAGTATGTCTGGGAGCTGGGGT
GGTCTTATGATTCGGGGACAACAGACGCCGTTTTCTCCACCTCCGACATCGGCCGATTTGAGGCAGTACCAGTTGGAGCC
ACGGCTGATGGCTTCTGCGCCCAACTCGAGAAGCAGCAGCAGCGCAGGCTCTCCTGGCTCGATGATCGGCGTATGCTCGC
CACTGGACTCTCCGTCGGCAGATCTCGCATTTCAGCACATGCAGGACCGCTTCCCCTTCAACAGCGCGGATGCCCATTCA
GCAACGGCCATTAGGGGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62