GenePrediction:GLEAN_1284 Details

Name: GLEAN_1284
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1860603..1862669 (+ strand)
Length: 2067
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1860603..1860851 (+ strand)
Length: 249
Type: CDS
Source: GLEAN
Position: GCSC_173:1860921..1862669 (+ strand)
Length: 1749
>GLEAN_1284 class=GenePrediction position=GCSC_173:1860603..1862669 (+ strand)
ATGTCAGGGACCTTGGACAAGCAGCAGCTGGTGCCCGGTGGGCACCTACGCCGCTCGGGCAATGTTCCAGAAACATTTGC
TACATTATGCCCCCCTTTCATCTACAGCAATTCCATCATCGTGGCGGCCACGAGCCCGGTTCTGGATGATTCCGACCAAA
AGCAAGACGGGTGGTTCATAAGTGATTTCTATGCTTTTAACTACATTTTCAAGAACCTAGGACAGCACCAGGTGTGGTTG
ACTAAGGTGGTATGTAGAGGCCTACTTCCGAATTAGGTCGCAATGTTTTTTTGTTTTTTTTTCTAATAAAGGCTGCAGGA
TCCTAGAATACTCGTGAAAAAGTTCGGCAACTATCTGCACGGCAATCCCTTCAAAGACCGGAAGGTTGTCTTGAGTAATG
AATTGCTGGACAATAAAGAATTGACAGCTGTCACTATTGTCAAAGACAACTTGCAAGAGAAATTCATCAAGGAAGCGAAG
CGCGCATCTGAACTTGCCGTCCAAACCAATGCACCCCTTCTTCTCATGCTGTTTTGTCATGGTATGGAAGCGGACAGAAT
GAAATCGCCAGCCGGCTCAAGCCGGATGATGCTACACAGCAAACATCGTGGACTTGAGGTTCAGGATCTAAAAGACGTCT
TAAATCCCAGCGCAAGAGTTACTCTGATCACATCGGCCTGCTATTCAGGCGGGTGGGTGGTCCACCCAGACCTGAACAAT
ACCAGCATGGCGGCTGCTGATGCAACAAGCGAGTCTATTTCCTGGAATGCCTCAGGAAGCATTGGTCGCTACTGTGGCTC
TGTGTTTGCTAGCAGTCTGATCGGCACCCTGACTAGCGTTGCGAGCCCTCTAGTCGAAACTGGCAGCGCCACAGAGAATC
CCGATGATCTGAGTTTGAAGTGTCTGTCACTATCCACATCTGGTTCACTACAGCCCGAGACACCTACGGAAGAACAGACT
CTTTCATACAATGCATTCTGTCACGAAGTTGTTGACACGCTGAGGACTAAGACACGCTTTTCCTTTGCACATCATTTGAC
ATTCAGTGCACAGAATGATGATTGGGAGTCTGCATGGATGAAACGGACAGGTATTCCTCTAGCCTTTTTCTCTGACCGGT
GGGACAAACTGGTATCTTGTCCTTATTCGGGAGCTCCGAGTCGTCTAGACCAAGACCCCCACAACCCCATGCTTTCAGAG
GACAGTGCTACAGAAGACGTTATTGTTCGGACCGGTGGAGCATACTCAGACATCACAGATCGGGTGACACTCGCCATGTT
GCATTCAAGGGCAATAGACTTGGCTGCTGCGTTCCTTGAGACCTGCCCGGGTGATGACGACAAAGGTTACGGTCCGCTTT
TTACTGGCACGTTGAGAGGACTGATCTGTGGCGATGACAATGTCCCACCGGCAGCAGAAATTATATGCTGGATCCAATTT
CGCTGGGATTTTGCCTTGATGACCGATGACATAGTTCGGCAACTGCGCCTTCCCATGCCAGGCGGGGAGCCCTGCCTGAT
GTGGCGTTCTTTCGAATTTCTTGAAAGTCTGTGGAAATCCGGCAGAACGGATTTCCAGGAACGACATGGAGAAATGTTTA
TGTCTCTGCTGCGTCGAGGTTTTATCACACGAGGCAATGAGGACCAAGGTCCACCCTTTAGGCGCCCAGCCTACTATTTG
GCGGCTGCCATTGTGGCAACAAATAAGTCTAAGGAGGACTGTGAAGTCCTGGCGGATCAAGTCGGGGCATACATCCACAA
GGCAAACATGTTGTATGCCGCGAAGGTTCTCGCAGAGTCTCCGAACTTGCGCAGGCGTGGACGGAATTGGGCAAAGTCGG
TCGGCCGCAATGTGCGGAGATCACTCTCGCCGAAGAAGAAGCGGTGGTCAATGCGCGAAATCATTGACAGCGACTCCCCG
GGAAGCAGTAGCAGTCAGCACCGCCCCAGTCTCGAAACCCAAACACGTCCGCGTGGCCTGTCTGGACTGGGGCATGTTCT
CGACCTCGCCGCCACCAGTGAGTCAAATGTGGAGAGGCGAAAGGGTGGACAAAATGGCCGTCGTTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62