GenePrediction:GLEAN_1285 Details

Name: GLEAN_1285
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1864219..1864545 (+ strand)
Length: 327
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1864219..1864545 (+ strand)
Length: 327
>GLEAN_1285 class=GenePrediction position=GCSC_173:1864219..1864545 (+ strand)
ATGAACACTGGAAGAGGAAGAAGAGGAAGACGTGATCGAAGAGACGCGCGGCGTACAGCACAAAGAGAGCAGGCGATACT
GGAGGCAACCCAAGCAGCGGAAGCTGCGGCAACTGCGGCAGCTGCCACGGAAGCGGCTAGGGCGAGAGTGCTATCGCAGA
CAAGGACTAGACACTTCACGCCGGCAGACGTCAGGGTCGCTGGTAATTTTGTCCTCAACACAGCGCCCATGCCGCGATTT
CCACCAACGGCGAGGCCCGCAAACTACCGATACGACAGACAGACCCAGTTCGCTGGCACCAGCCATGTGGCCCAAGGCTA
CCAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62