GenePrediction:GLEAN_1287 Details

Name: GLEAN_1287
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1870426..1871997 (+ strand)
Length: 1572
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1870426..1870485 (+ strand)
Length: 60
Type: CDS
Source: GLEAN
Position: GCSC_173:1870536..1870833 (+ strand)
Length: 298
Type: CDS
Source: GLEAN
Position: GCSC_173:1870895..1871835 (+ strand)
Length: 941
Type: CDS
Source: GLEAN
Position: GCSC_173:1871899..1871997 (+ strand)
Length: 99
>GLEAN_1287 class=GenePrediction position=GCSC_173:1870426..1871997 (+ strand)
ATGGCAGGAACAATTCTCAACATCAGAGACTTCCCGACGCGTCACATTGTTGGCAACAAGGTAGAGGGACTTTATCGTGT
CTGCATGGATGCGCGGCTGACGTTTATCAGTCCTTCGAAGGCCATGGGCCTACTCTGTCGCTTTCCAATCCCAAAGACGG
CAGCTCTATTGTTTCTCTAAATGGAGTCTCGACAGAAGATGTTGACCAGGCCGTCGGAGAAGCCCAAAAGGCTATGAACG
GAGACTGGGCTACATACTCTGGAGCACAGCGAGCTCTTTGTCTGAATAAGTTTGCAGATCTTCTGGATGAATACGCAGAA
GCCATTGGGTACTTTGAGAGCATCTGCTCCGGAAGACCGCTTGGACAGGTCGTCGCTGAGATACCCAGGGTTTCAGCCGT
CTACAGATGTGAGAAAGGTCCTCCGGTTCATTTTCTCATGCTCTCGACGCTAAAACCTAATTTATGTAGATTATGCAGGA
TGGGCAGACAAGATCAAGGGAGACGCGTACGTGGCTGACGACGGATTCTACAAGATTGTGCGGCACGAACCGCTCGGCGT
GTGTGCTGGAATCACGGCTTGGAACGGCTCTTTGCACTTTCTGTCGTGGAAATCGGCCCCTGCACTGGCCTGCGGAAATG
TGGTGCTGATCAAGCCGTCGGAAAAGTCACCGCTTGGCACGATGGCTGCCAGCTATCTGATCCAAGCCGCAGGCTTTCCA
CCCGGCGTCTTCCAGATTCTTGCTGGAGGCGGCGAGATTGGAGCGCATCTGAGTAGCCACATGGACATCCAGAAGATCAG
TTTCACCGGATCCGGCGTCACCGGGCGCAAGATCCAAGAGGCTGCCACACGCAGCAACCTCAAACGGGTTACGCTGGAAC
TTGGTGGCAAGAGCCCCGGCATCGTCTTTGACGACGCCAATCTCGACACCGCTCTCTTCTGGTGTGTTTTAAGCATCACG
GCAAATTCAGGGCAGGTGTGCGCTGCCACATCGCGGCTGCTGCTGCAGGAAAGCATCGCTGAAGAGTTCCTGAAGCGCAT
CAAATCCCAGTTTGAGGCCATCGCGACAACCCTGGGCGCTGACCCGCAGGACAAGTCCACCACATATGGGCCGCTGGTTG
ACAAGCTCCAGTACGAGAAAGTTCAGAGATACATCCGCTCTGGACAGAATACATCGCAGCTGATCACTGGAGGCATCGAG
GACGAGAAGAGCACGGCGGGCTATTACGTCGCGCCAACTATCTTCCTGAACCCCAAGGATGATGATCCCATCTACCGAGA
AGAAGTATTTGGTCCCGTCCTGTGCGTCAAGACATTCAAGACGGAAGAGGAAGCCATCACGATGGGAAACGATACAGAGT
ACGGCCTTGCAGGGTCCGTCTACACGGAAACGACCAAACGTGCCCTCCGAGTGAGTGCCAGGCTGCGAGCTGGAACAGTC
GGGGTCAATTGTGCCGCTGTAGTTGGCCCTCAGGTCCCCATGGGCGGCTTCGGGAGCAGTGGCATCGGCAGGGAGCTAGG
TGAGTATGCACTGCGACACTACACGGAGCCAAAGTCGATATGGATCAAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62